'Hiv evolution' diaporamas de présentation

Supporting Scientific Collaboration Online

Supporting Scientific Collaboration Online. SCOPE Workshop at San Diego Supercomputer Center March 19-22, 2008. Workshop Structure Overview. Introductions to working with: a Problem Space an Investigative Case OERCommons Visualization tools CaseIT Planting Science

286 views • 20 slides

Evolution and transmission in HIV

181 views • 18 slides

Investigations of HIV-1 Env Evolution

Investigations of HIV-1 Env Evolution. University of Tennessee - Knoxville June 22-26, 2009. HIV Life Cycle. HIV Virus. The HIV Genome. HIV env Gene. gp120 V3 region sequence. Nucleic Acid Sequence CTAGCAGAAGAAGAGGTAGTAATTAGATCTGCCAATTTCACAGACAATGCTAAAATCATAATAGTACAGC

285 views • 14 slides

Investigations of HIV-1 Env Evolution

Investigations of HIV-1 Env Evolution. University of Tennessee - Knoxville June 22-26, 2009. HIV Life Cycle. HIV Virus. The HIV Genome. HIV env Gene. gp120 V3 region sequence. Nucleic Acid Sequence CTAGCAGAAGAAGAGGTAGTAATTAGATCTGCCAATTTCACAGACAATGCTAAAATCATAATAGTACAGC

280 views • 14 slides

Syllabus - course goals and philosophy - questions Who are you? What is evolution?

146 views • 5 slides

Materials and Methods

Characterizing Constraints Acting On HIV-1 Viral Evolution. Jeongmin Woo, Simon C. Lovell and David L. Robertson

94 views • 1 slides

Materials and Methods

Characterizing Constraints Acting On HIV-1 Viral Evolution. Jeongmin Woo, Simon C. Lovell and David L. Robertson

151 views • 1 slides