Insert sizes - PowerPoint PPT Presentation

cosmids

cosmids. Cosmids are plasmid vectors that contain one or two “cos sites”. (The cos site and the length between 2 cos sites is the only requirement for DNA to be packaged into a phage particle). How do we clone DNA into a cosmid vector ? 1. We use a polylinker.

★ ★ ★ ★ ★

4.07k views • 30 slides

De Novo Genome Assembly - Introduction

De Novo Genome Assembly - Introduction. Henrik Lantz - BILS/ SciLife /Uppsala University. De Novo Assembly - Scope. De novo genome assembly of eukaryote genomes Bioinformatics in general, programs in particular Practical experience Ease of entry - not memorization.

★ ★ ★ ★ ★

507 views • 29 slides

Genome Assembly

Genome Assembly. Bonnie Hurwitz Graduate student TMPL. Genome assembly. Genome assembly. …ACGGCTGCGTTACATCGATCAT. ACATCGATCATTTACGATACCATTG…. genomic DNA. Shotgun sequencing (WGS). sheared. clone library (insert sizes of 1-2, 3-4, 30-40, 100kb). end sequence clones (f / r).

★ ★ ★ ★ ★

535 views • 10 slides

View Insert sizes PowerPoint (PPT) presentations online in SlideServe. SlideServe has a very huge collection of Insert sizes PowerPoint presentations. You can view or download Insert sizes presentations for your school assignment or business presentation. Browse for the presentations on every topic that you want.