SlideServe Logo
  • Browse
    • Recent Presentations
    • Recent Articles
    • Content Topics
    • Updated Contents
    • Featured Contents

    • PowerPoint Templates
    • Presentation
    • Article
    • Survey
    • Quiz
    • Lead-form
    • E-Book
  • Pro
  • Upload

Insert sizes - PowerPoint PPT Presentation


cosmids

cosmids

cosmids. Cosmids are plasmid vectors that contain one or two “cos sites”. (The cos site and the length between 2 cos sites is the only requirement for DNA to be packaged into a phage particle). How do we clone DNA into a cosmid vector ? 1. We use a polylinker.

★ ★ ★ ★ ★

4.08k views • 30 slides



De Novo Genome Assembly - Introduction

De Novo Genome Assembly - Introduction

De Novo Genome Assembly - Introduction. Henrik Lantz - BILS/ SciLife /Uppsala University. De Novo Assembly - Scope. De novo genome assembly of eukaryote genomes Bioinformatics in general, programs in particular Practical experience Ease of entry - not memorization.

★ ★ ★ ★ ★

516 views • 29 slides


Genome Assembly

Genome Assembly

Genome Assembly. Bonnie Hurwitz Graduate student TMPL. Genome assembly. Genome assembly. …ACGGCTGCGTTACATCGATCAT. ACATCGATCATTTACGATACCATTG…. genomic DNA. Shotgun sequencing (WGS). sheared. clone library (insert sizes of 1-2, 3-4, 30-40, 100kb). end sequence clones (f / r).

★ ★ ★ ★ ★

540 views • 10 slides


View Insert sizes PowerPoint (PPT) presentations online in SlideServe. SlideServe has a very huge collection of Insert sizes PowerPoint presentations. You can view or download Insert sizes presentations for your school assignment or business presentation. Browse for the presentations on every topic that you want.

  • English
  • Français
  • About
  • Privacy
  • DMCA
  • Blog
  • Contact
© 2026 SlideServe. All rights reserved.