100+ Pool 2 pairs PowerPoint (PPT) Presentations, Pool 2 pairs PPTs

Pool 2 pairs - PowerPoint PPT Presentation

Genome closure and finishing

Genome closure and finishing. Clone walking. clone insert (from shotgun library). primer locations. Already sequenced. Unsequenced. sequencing primer. direction of extension. tgcatgatcgtgatcat acgtactagcactagtactgtagtcgatgcactgatcgatcgatcgatgctacgatgcatgct. PCR to close gaps. Scaffold.

★ ★ ★ ★ ★

296 views • 21 slides

View Pool 2 pairs PowerPoint (PPT) presentations online in SlideServe. SlideServe has a very huge collection of Pool 2 pairs PowerPoint presentations. You can view or download Pool 2 pairs presentations for your school assignment or business presentation. Browse for the presentations on every topic that you want.

'Pool 2 pairs' diaporamas de présentation

Pool 2 pairs - PowerPoint PPT Presentation

Genome closure and finishing