'Single gene mutations' diaporamas de présentation

Dr. Sharda Jain Director: Global Institute of Gynaecoloy at Pushpanjali Crosslay Hospital Secretary general: Delhi Gyn

Recurrent Pregnancy Loss. Dr. Sharda Jain Director: Global Institute of Gynaecoloy at Pushpanjali Crosslay Hospital Secretary general: Delhi Gynaecologist Forum. Learning Objectives. Identify possible causes of early pregnancy loss

1.08k views • 91 slides

Single Gene Mutations and Inheritance II April 4, 2008

Single Gene Mutations and Inheritance II April 4, 2008. Lisa Schimmenti, M.D. Objectives. Understand autosomal recessive inheritance. Know the concept of Lyonization. Learn and understand the various forms of X linked inheritance.

947 views • 47 slides

Chapter 12 Human Genetics

Chapter 12 Human Genetics . Modern Study of Genetics. 1882: Flemming observed threadlike chromosomes in the nuclei of dividing cells 1887: Weismann suggested that meiosis halves the number of chromosomes when gametes are made

420 views • 41 slides

Lecture outline

Lecture outline. Self-tolerance: concept, significance Mechanisms of central and peripheral tolerance: deletion, anergy, regulatory T cells Pathogenesis of autoimmunity: roles of susceptibility genes and environmental factors.

835 views • 33 slides

Central Dogma of Molecular Biology

382 views • 33 slides

Unit 6

Unit 6. DNA. Griffith Experiment. DNA Structure. DNA is a polymer made of monomers called nucleotides Each nucleotide is made of: A phosphate group Deoxyribose (sugar) Nitrogen containing base. DNA Structure. DNA is in the shape of a double helix Each nucleotide is paired.

318 views • 20 slides

A single strand of DNA is made of letters: ATGCTCGAATAAATGTGAATTTGA

A single strand of DNA is made of letters: ATGCTCGAATAAATGTGAATTTGA The letters make words: ATG CTC GAA TAA ATG TGA ATT TGA The words make sentences: <ATG CTC GAA TAA> <ATG TGA ATT TGA> These "sentences" are called genes. Genes tell the cell to make other molecules called proteins

619 views • 17 slides

EPIGENETICS Textbook

458 views • 17 slides

A single strand of DNA is made of letters: ATGCTCGAATAAATGTGAATTTGA

A single strand of DNA is made of letters: ATGCTCGAATAAATGTGAATTTGA The letters make words: ATG CTC GAA TAA ATG TGA ATT TGA The words make sentences: <ATG CTC GAA TAA> <ATG TGA ATT TGA> These "sentences" are called genes. Genes tell the cell to make other molecules called proteins

196 views • 17 slides

Gene Mutations

172 views • 15 slides

Neurobiology of Learning and Memory Prof. Anagnostaras

Neurobiology of Learning and Memory Prof. Anagnostaras. Lec 10: Mental Retardation. What is retardation?. DSM Criteria IQ of 70 or below (Normal mean = 100, SD = 15, so 2 SD) Deficits or impairments in present adaptive functioning in at least two of the following:

340 views • 12 slides