shadi
Uploaded by
34 SLIDES
654 VUES
350LIKES

pGLO lab

DESCRIPTION

pGLO lab. The importance of DNA. The DNA double helix is the code of life. DNA is the code to make proteins The blueprint for all structures in your body which are made of protein DNA is comprised of nucleotides. Nulceotides are the monomers of nucleic acid polymers.

1 / 34

Télécharger la présentation

pGLO lab

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. pGLO lab

  2. The importance of DNA

  3. The DNA double helix is the code of life • DNA is the code to make proteins • The blueprint for all structures in your body which are made of protein • DNA is comprised of nucleotides

  4. Nulceotides are the monomers of nucleic acid polymers • Consist of a sugar, a phosphate, and a nitrogen-containing base • Sugar can be deoxygenated • Bases contain the genetic information

  5. There are 4 kinds of DNA bases

  6. Adenine always matches with Thymine, Cytosine always matches with Guanine-Hydrogen bonds hold bases together

  7. Cellular machinery is sophisticated and required for life Cellular machinery is made largely of proteins Blueprints for all cellular machinery are contained in genes Genes are inherited from parents Humans have ~30,000 genes Living things are extremely complex

  8. Proteins give living things the variety of their structures

  9. Protein variety is generated by 1o structure- the sequence of amino acids which make the protein

  10. Amino Acids • Proteins consist of subunits called amino acids Figure 2.12

  11. How DNA works • Replication • Transcription • Translation

  12. The sequence of DNA bases is the code for the primary structure of proteins

  13. All cells require a copy of the genome • Genome- all the genes of the cell • Human genome is made of DNA • DNA is similar in all cells • Gene- 1 DNA Molecule (+ proteins the genetic information to produce a single product (protein) • DNA replication copies all cellular DNA

  14. Replication of DNA Figure 21.2

  15. The DNA code

  16. Computers use binary digital code • 01100001 = A • 01100010 =B • 01000011 =c • 00100111 = apostrophe • Etc. • http://www.geek-notes.com/tools/17/text-to-binary-translator/ 01000011 01101000 01100101 01100101 01110011 01100101 01100010 01110101 01110010 01100111 01100101 01110010 00100000 01000100 01100101 01101100 01110101 01111000 01100101 = cheeseburger deluxe

  17. How does the DNA code work? • atggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttc=GFP

  18. The DNA code is (nearly) universal It uses groups of 3 bases (codon) 3 bases = 1 codon = 1 amino acid

  19. The Central Dogma of Molecular Biology • DNA RNA Protein • DNARNA : Transcription • RNA Protein: Translation

  20. DNA RNA Protein Trait

  21. The Universality of the DNA code makes this possible Firefly gene (Luciferase) in a tobacco plant

  22. tRNA’s carry an amino acid at one end, and have an anticodon at the other Amino acid attachment site: Binds to a specific amino acid. Amino acid (phenylalanine) Anticodon: Binds to codon on mRNA, following complementary base-pairing rules. Anticodon mRNA Figure 21.6

  23. The ribosome matches tRNA’s to the mRNA, thereby linking amino acids in sequence

  24. In this way, the proteins in nature are virtually limitless

  25. Proteins are incredibly diverse at the molecular level A few examples Insulin Rubisco ATP synthase Fibrin Nitrogenase Protein function depends greatly on shape

  26. Because the DNA code is universal, genes can be moved from one living thing to another Cell with gene of interest Bacterium Step 1: Isolate DNA from two sources. Plasmid Source (donor) DNA Fragments of source DNA Step 2: Cut both DNAs with the same restriction enzyme. Step 3: When mixed, the DNAs recombine by base pairing. Figure 21.14 (1 of 2)

  27. When one DNA molecule is copied to make two DNA molecules, the new DNA contains •  A) 25% of the parent DNA.   • B) 50% of the parent DNA.   • C) 75% of the parent DNA.   • D) 100% of the parent DNA.   • E) none of the parent DNA.

  28. DNA in action • HIV and AIDS • Genetic engineering • pGLO

  29. Genetic Engineering allows DNA to be moved from one organism to another Figure 21.14

  30. Green Fluorescent Protein 40 Å 30 Å • discovered in 1960s by Dr. Frank Johnson and colleagues • closely related to jellyfish aequorin • absorption max = 470nm • emission max = 508nm • 238 amino acids, 27kDa • “beta can” conformation: 11 antiparallel beta sheets, 4 alpha helices, and a centered chromophore • amino acid substitutions result in several variants, including YFP, BFP, and CFP

  31. The pGLO plasmid has genes which can be turned on and off ori- origin of replication GFP- green fluorescent protein bla- Beta-lactamase araC- Arabinose What are all the other marks? Why are they there?

  32. 2008 Nobel Prize- GFP GFP mice

  33. Gene Regulation ara GFP Operon ara Operon araC GFP Gene araC B A D Effector(Arabinose) Effector (Arabinose) araC B A D araC GFP Gene RNA Polymerase RNA Polymerase B A D araC araC GFP Gene On pGLO, the regulatory regions of the Arabinose operon have been glued to the structural sequences for GFP What will happen on the Ara (+) plates? What will happen on the Ara (-) plates?

  34. Which colonies will glow? LB/Amp LB/Amp/Ara LB Grow? Glow? • Follow protocol • On which plates will colonies grow? • Which colonies will glow? 8/21/2014 34

More Related