1 / 11

PoBoL – in 5min

PoBoL – in 5min. Michal Galdzicki 7/26/2009. Provisional BioBrick Language ( PoBoL ). Pobol also means “people” in Welsh Proposed information exchange standard Community effort Structured Data Format Modular. Dynamic Models SBML. RNA Parts. Protein Parts.

shania
Télécharger la présentation

PoBoL – in 5min

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. PoBoL – in 5min Michal Galdzicki 7/26/2009

  2. Provisional BioBrick Language (PoBoL) • Pobol also means “people” in Welsh • Proposed information exchange standard • Community effort • Structured Data Format • Modular

  3. Dynamic Models • SBML • RNA Parts • Protein Parts Modular architecture to encourage re-use, maintenance and evolution Extensible Different authors Independent evolution Explicit differences

  4. PoBoL Structure • Based on the Standard Biological Parts Registry layout • Specific • Terminology • Structure • 7 Classes BioBrick BioBrick Basic is-a BioBrick Composite BioBrick Vector BioBrickFormat DNA Sample

  5. Structure illustrated through Canton, et al. ‘08example BBa_F2620 BBa_F2620 subPart: BBa_R0011 BBa_B0010 BBa_B0012 BBa_C0062 BBa_R0040 BBa_B0034 subPart: BBa_I0462 http://partsregistry.org/Part:BBa_F2620

  6. PoBoL aims to represent minimal BioBrick™ information BBa_F2620 BBa_R0011 BioBrickComposite: BioBrickBasic: DNAsequencetccctatcagtgatagagattgacatccctatcagtga tagagatactgagcactactagagaa… 1061bp DNAsequenceacctgtaggatcgtacaggtttacgc aagaaaatggtttgttatagtcgaat aaa shortDescriptionreceiver for bacterial signals shortDescriptionPromoter activated by LuxR in concert with HSL subPart BioBrickBasic: format BioBrickFormat: BBa_R0040 BBa_B0034 21 10 23 25 BBa_C0062 BBa_B0010 author Vinay S Mahajan, VoichitaMarinescu, Brian Chow, Alexander Wissner-Gross and Peter Carr BBa_B0012 BBa_R0011 … … BBF RFC 31: Provisional BioBrickLanguage (PoBoL) doi: 1721.1/45537

  7. PoBoLis a BioBrick™ semantic model BioBrick • Relationships between Individual BioBricks • Explicit assumptions regarding the intended meaning is-a BioBrickBasic B0034 subPart C0062 B0010 B0012 is-a BioBrickComposite I0462 is-a insert DNA BioBrickVector DNA55 pSB1A2 vector BioBrickFormat Sample format contains Sample56 Assembly Standard 10

  8. Conforms to W3C information technology standards Semantic Web Standards • Common Ontology • Concerned with definition of meaning • A formal specification of the domain • Web Ontology Language (OWL) • Access layer • XML -> RDF -> OWL

  9. Compliance with W3C grants ability to read, manipulate, and interpret • APIs for: Java, Perl, Python, PHP, Ruby, Javascript, .Net / Mono,C, C++,Lisp, Prolog • For example: • OWL API, Jena • Management of model structure • Protégé • Check consistency and infer data types • Pellet

  10. History • Spring ’08 Standards and Specifications in Synthetic Biology Workshop • Volunteer Work: pobol.org; pobol Google Group • May 2009 – BBF RFC 31 released • Since: Comments & proposed extensions • Future: Leveraging OWL-DL

  11. Legend Sample Extending /changing PoBoL Composition hasDNA Inheritance DNA hasInsert hasBackbone hasFormat BioBrick BioBrickFormat hasPart DNA Parts Tree DNA Part Plasmid Backbone Promoter RBS CDS Protein Generator & Slide from: Alec Nielsen proposed update to the document linked below http://bbf.openwetware.org/RFC.html#BBF_RFC_31:_Provisional_BioBrick_Language_.28PoBoL.29

More Related