110 likes | 224 Vues
PoBoL – in 5min. Michal Galdzicki 7/26/2009. Provisional BioBrick Language ( PoBoL ). Pobol also means “people” in Welsh Proposed information exchange standard Community effort Structured Data Format Modular. Dynamic Models SBML. RNA Parts. Protein Parts.
E N D
PoBoL – in 5min Michal Galdzicki 7/26/2009
Provisional BioBrick Language (PoBoL) • Pobol also means “people” in Welsh • Proposed information exchange standard • Community effort • Structured Data Format • Modular
Dynamic Models • SBML • RNA Parts • Protein Parts Modular architecture to encourage re-use, maintenance and evolution Extensible Different authors Independent evolution Explicit differences
PoBoL Structure • Based on the Standard Biological Parts Registry layout • Specific • Terminology • Structure • 7 Classes BioBrick BioBrick Basic is-a BioBrick Composite BioBrick Vector BioBrickFormat DNA Sample
Structure illustrated through Canton, et al. ‘08example BBa_F2620 BBa_F2620 subPart: BBa_R0011 BBa_B0010 BBa_B0012 BBa_C0062 BBa_R0040 BBa_B0034 subPart: BBa_I0462 http://partsregistry.org/Part:BBa_F2620
PoBoL aims to represent minimal BioBrick™ information BBa_F2620 BBa_R0011 BioBrickComposite: BioBrickBasic: DNAsequencetccctatcagtgatagagattgacatccctatcagtga tagagatactgagcactactagagaa… 1061bp DNAsequenceacctgtaggatcgtacaggtttacgc aagaaaatggtttgttatagtcgaat aaa shortDescriptionreceiver for bacterial signals shortDescriptionPromoter activated by LuxR in concert with HSL subPart BioBrickBasic: format BioBrickFormat: BBa_R0040 BBa_B0034 21 10 23 25 BBa_C0062 BBa_B0010 author Vinay S Mahajan, VoichitaMarinescu, Brian Chow, Alexander Wissner-Gross and Peter Carr BBa_B0012 BBa_R0011 … … BBF RFC 31: Provisional BioBrickLanguage (PoBoL) doi: 1721.1/45537
PoBoLis a BioBrick™ semantic model BioBrick • Relationships between Individual BioBricks • Explicit assumptions regarding the intended meaning is-a BioBrickBasic B0034 subPart C0062 B0010 B0012 is-a BioBrickComposite I0462 is-a insert DNA BioBrickVector DNA55 pSB1A2 vector BioBrickFormat Sample format contains Sample56 Assembly Standard 10
Conforms to W3C information technology standards Semantic Web Standards • Common Ontology • Concerned with definition of meaning • A formal specification of the domain • Web Ontology Language (OWL) • Access layer • XML -> RDF -> OWL
Compliance with W3C grants ability to read, manipulate, and interpret • APIs for: Java, Perl, Python, PHP, Ruby, Javascript, .Net / Mono,C, C++,Lisp, Prolog • For example: • OWL API, Jena • Management of model structure • Protégé • Check consistency and infer data types • Pellet
History • Spring ’08 Standards and Specifications in Synthetic Biology Workshop • Volunteer Work: pobol.org; pobol Google Group • May 2009 – BBF RFC 31 released • Since: Comments & proposed extensions • Future: Leveraging OWL-DL
Legend Sample Extending /changing PoBoL Composition hasDNA Inheritance DNA hasInsert hasBackbone hasFormat BioBrick BioBrickFormat hasPart DNA Parts Tree DNA Part Plasmid Backbone Promoter RBS CDS Protein Generator & Slide from: Alec Nielsen proposed update to the document linked below http://bbf.openwetware.org/RFC.html#BBF_RFC_31:_Provisional_BioBrick_Language_.28PoBoL.29