sharis
Uploaded by
14 SLIDES
308 VUES
140LIKES

DNA Computing: Solving the Traveling Salesman Problem and Beyond

DESCRIPTION

This lecture explores the innovative field of DNA computing, highlighting its application in the Traveling Salesman Problem (TSP) first tested by Leonard Adleman in 1994. We delve into how DNA strands can represent cities and flight paths, using principles of genetic bonding to explore all potential itineraries. Additionally, we discuss advanced applications of DNA computers, including their potential for parallel processing, low power consumption, and future medical software that could revolutionize disease detection and treatment at the cellular level.

1 / 14

Télécharger la présentation

DNA Computing: Solving the Traveling Salesman Problem and Beyond

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Computing with DNA Many thanks to Dave Bevan for providing some of the material for this lecture.

  2. The Central Dogma

  3. Graphical Representation of inherent bonding properties of DNA

  4. Travelling Salesman Problem • In early 1994, Adleman put his theory of DNA computing to the test on a problem called the Traveling Salesman Problem.

  5. Travelling Salesman Problem • Only need to keep those paths that exhibit the following properties: • The path must start at city A and end at city G. • Of those paths, the correct paths must pass through all 7 cities at least once. • The final path must contain each city in turn.

  6. Example:

  7. Travelling Salesman Problem • Adleman, created randomly sequenced DNA strands 20 bases long to chemically represent each city and a complementary 20 base strand that overlaps each city’s strand halfway to represent each street

  8. The principle • This can be thought of as building blocks that have a certain “pattern”. Only the parts with matching patterns can be put together • In the diagram below, whole color blocks are the cities and split color blocks represent the paths from one city to another C B => C C => D

  9. How it works? I. Represent each of the cities as single-stranded DNA molecules, each with 20 arbitrary nucleotides. Nucleotides are the building blocks of DNA, and they exist as four different bases: adenine, thymine, guanine, and cytosine (denoted by the letters A, T, G, and C, respectively). For example, San Diego = TTGACGAATG ATGCTAGAAA, Atlanta = AATCCATGCG AAATTAGCCC, St. Louis = TATGACCTAG CTAGCATAGC, etc.

  10. How it works? II. Assign flight names for all the possible flight paths, combining the last 10 nucleotides of the departure city with the first ten nucleotides of the arrival city. For example, a flight leaving St. Louis and arriving in Atlanta would be denoted as CTAGCATAGCAATCCATGCG. If this encounters the complement of the Atlanta city name (TTAGGTACGC TTTAATCGGG) in solution, the segment coding AATCCATGCG will hydrogen bond to the segment coding TTAGGTACGC, leading to 

 CTAGCATAGCAATCCATGCG |||||||||| TTAGGTACGC TTTAATCGGG This structure can in turn bond to a flight leaving from Atlanta, and so on.

  11. How it works? III. First synthesize DNA strands representing all cities and flight connections. Using DNA ligase, which “glues” DNA molecules together, allow the DNA strands to combine and form all possible itineraries. Make sure there is enough copies of each DNA molecule to ensure that all flight plans could form. Use polymerase chain reaction (PCR) to make multiple copies of only those itineraries with the correct departure and arrival destination. Select only those of the right length that contain the the sequence for the start and end cities.

  12. How it works? • Using gel electrophoresis, all possible travel paths are “sorted” by their total length • Shorter fragments travel faster through the gel • If the path goes through all of the cities at least ones, it is considered correct Long Short

  13. Beyond the Traveling Salesman • DNA logic circuits • 74 DNA strand circuit capable of computing the square root of 4 digit binary numbers • Computer-aided DNA • Synthetic genes • Improving genetic pathways • Living computers? • Cells that are fully automated computational machines

  14. Potential Advantages of a DNA Computer • Parallel Computing- DNA computers are massively parallel. • Adleman’s experiment performed at a rate of 100 teraflops, or 100 trillion floating point operations per second. By comparison, NEC Corporation’s Earth Simulator, the world’s fastest supercomputer, operates at approximately 36 teraflops. • Incredibly light weight- With only 1 LB of DNA you have more computing power than all the computers ever made. • Low power- The only power needed is to keep DNA from denaturing. • Medical applications: a computer to identify given disease at each cell and launch a cell-specific cure.

More Related