Download
slide1 n.
Skip this Video
Loading SlideShow in 5 Seconds..
White (2n = 40) PowerPoint Presentation
Download Presentation
White (2n = 40)

White (2n = 40)

89 Vues Download Presentation
Télécharger la présentation

White (2n = 40)

- - - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

  1. Linkage disequilibrium (LD) across the NPY1R locus: Common polymorphisms discovered by re-sequencing in 4 human populations Black (2n = 40) Asian (2n = 40) Hispanic (2n = 40) White (2n = 40) Numbers in diamonds: LD as r2*100 LD blocks defined by four gamete rule r2 color scheme: r2=0, white; 0<r2<1, shades of grey; r2=1: black. On-line Figure 1

  2. On-line Figure 2: NPY1R 3’-UTR polymorphism A+1050G influences gene expression in cella in 3 different cell lines: PC12 chromaffin cells, human embryonic kidney (HEK) cells, and HeLa fibroblasts. Results are shown at 24 h post-transfection. On-line Figure 2

  3. On-line Figure 3A Human variant TCACTTTACCTAGCAGGGAAAAG-TACACAAAAACTGCAGATACT Human wild-type TCACTTTACCTAGCAGGGAAAAA-TACACAAAAACTGCAGATACT Chimp TCACTTTACCTAGCAGGGAAAAA-TACACAAAAACTGCAAATACT Macaca TCACTTCACCTAGCAGGGAAAAAATACACAAAAACTGAGAATACT Conservation ****** *************** ************* ***** 3’-UTR A+1050G On-line Figure 3A Human NPY1R 3’-UTR Variant Inter-species Sequence Alignment. The alignment shown spans 45 bp flanking the polymorphism. The polymorphic base is shown in uppercase bold type. Asterisks (*) indicate that the position is identical in all sequences shown. Sequence alignment by Clustal-W.

  4. On-line Figure 3B:Human NPY1R promoter variant A-585T inter-species sequence alignment. The alignment shown spans 60 bp flanking the polymorphism. The polymorphic base is shown in uppercase bold type. Asterisks (*) indicates that the position is identical in all sequences shown. Sequence alignment by Clustal-W. Human variant GCTAAGCGCTGGGAACAAATCTGACTTATTGCATTTTCTCAGTGGGCCAAAGAAAGGAGG Human wild-type GCTAAGCGCTGGGAACAAATCTGACTTAATGCATTTTCTCAGTGGGCCAAAGAAAGGAGG Chimp GCTAAGCGCTGAGAACAAATCTGACTTAATGCATTTTCTCAGTGGGCCAAAGAAAGGAGG Rhesus ACTTAGCGCTGGGAACAAATCTGACTTAATGCATTTTCTCAGTGGGCCAAAGAAAGGAGG ** ******* **************** ******************************* A-585T On-line Figure 3B