1 / 9

Review – Chapter 4

Review – Chapter 4. Chapter 4. Name three differences between plant and animal cells. A – Plant cells – cell wall, larger vacuoles, chloroplasts. Animal cells – flagellum and cilia What is the purpose of the ribosome? A – Produces proteins What is the power house of the cell?

sibley
Télécharger la présentation

Review – Chapter 4

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Review – Chapter 4

  2. Chapter 4 • Name three differences between plant and animal cells. A – Plant cells – cell wall, larger vacuoles, chloroplasts. Animal cells – flagellum and cilia • What is the purpose of the ribosome? A – Produces proteins • What is the power house of the cell? A – Mitochondria

  3. Cell Parts Continued • What is the purpose of the endoplasmic reticulum? A – To transport materials within the cell. • How do proteins leave the cell? A – They are packaged in vesicles (at the end of the Golgi body) and are carried to the cell membrane. • What would happen if the nucleus of a cell was taken out? A – The cell would die.

  4. DNA • Where is DNA found? A – The nucleus • What does DNA stand for? A – deoxyribonucleic acid • What shape does DNA take? A – Double helix • What three parts make up DNA? A – Sugar, phosphate, and bases

  5. DNA • What does A, G, C and T stand for? A – adenine, guanine, cytosine, and thymine • What does adenine pair with? A – thymine • Most of the time, DNA exists in the nucleus in the form of what? A – chromatin • What does DNA code for? A – proteins

  6. Chromosomes • How many pairs of chromosomes are found in human cells? A – 23 pairs • If your 23rd pair of chromosomes is XY, you would be a … A – male/boy • Small segments of DNA are called what? A - genes

  7. Genes/Proteins • What is the importance of genes? A – stores information needed to produce specific proteins. • Which of the following are not specialized proteins: hormones, nucleolus, enzyme? A – nucleolus • Why are stomach cells different from skin cells? A – different proteins have been made for each cell.

  8. Protein Production • What does RNA stand for? A – ribonucleic acid • How is the message for a protein to be made carried from the nucleus to the ribosomes? A – DNA message for a specific protein is copied into RNA which leaves through the nuclear pore and delivers the message to the ribosome. • What is the function of the Golgi body? A – To repackages the protein for transport out of the cell.

  9. Mutations • What type of mutation is occurring in the following DNA sequence (and where): CATGCCTGACGTCTGATGCCA Mutation 1: CATGCCTGACCTCTGATGCCA A – Substitution – CATGCCTGACCTCTGATGCCA Mutation 2: CATGCCTGACGTCTGATGCCAA A – Addition – CATGCCTGACGTCTGATGCCAA Mutation 3: CATCCTGACGTCTGATGCCA A – Deletion - CATCCTGACGTCTGATGCCA

More Related