1 / 28

The Case of the Druid Dracula: Clicker Case Version

by Norris Armstrong, Terry Platt, and Peggy Brickman. The Case of the Druid Dracula: Clicker Case Version. Adapted from Brickman (2004). The Case of the Druid Dracula . National Center for Case Study Teaching in Science, University at Buffalo, State University of New York. . The Crime.

sirvat
Télécharger la présentation

The Case of the Druid Dracula: Clicker Case Version

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. by Norris Armstrong, Terry Platt, and Peggy Brickman The Case of the Druid Dracula: Clicker Case Version Adapted from Brickman (2004). The Case of the Druid Dracula. National Center for Case Study Teaching in Science, University at Buffalo, State University of New York.

  2. The Crime In a quiet corner of Wales in the village of Llanfairpwll, 90-year-old Mabel Leyshorn was murdered. Her murder had been not only brutal (her heart had been hacked out), but also creepy. It appeared as if the Mabel’s blood had been collected in a small kitchen saucepan and tasted. The murder showed other signs of the occult: a candlestick and a pair of crossed pokers had been arranged near the body. - from BBC’s Crimewatch December 2001

  3. The Crime Scene Further investigation indicated that this was no supernatural villain at work: the murderer had worn tennis shoes which had left distinctive footprints under the glass door that had been shattered by a piece of broken garden slate. Moreover, the windowsill had bloodstains on it; with any luck, the evidence recovery unit hoped to use it to help determine who had committed the crime.

  4. CQ1: What is your blood type? A: A B: B C: AB D: O E: Don’t know

  5. Evidence in the Courtroom • Blood was previously used for blood typing • Now used as source of DNA • Primarily rape cases • Paternity testing • Historical/missing persons investigations • Military “dog tag” • Convicted felon databases Sources of DNA? Uses for DNA fingerprinting

  6. Target Gene DNA in the Cell chromosome double stranded DNA molecule individual nucleotides

  7. Example: Amelogenin Gene • Tooth enamel development • Copies on X and Y chromosome • X copy is different from Y copy • --- indicates missing bases X copy is shorter than Y copy 5’CCCTAGGGTCTATAACGCCTAGTGTGTTGATTC 5’ 3’GGGATCCCAGATATTGCGGATCACACAACTAAG 3’ Y: X: 5’CCCTAGGGTCTA---------GTGTGTTGATTC 5’ 3’GGGATCCCAGAT---------CACACAACTAAG 3’ GTGTGTTGATTC 3’ CACACAACTAAG 5’

  8. (-) Negative electrode bp? bp? (+) Positive electrode Gel Electrophoresis: Sizing DNA Fragments

  9. CQ2: The DNA fragment indicated is approximately ____ base pairs in size. A: 300 B: 350 C: 580 D: 600 E: 700 bp?

  10. Why do the two DNA fragments indicated differ in how bright they appear?

  11. DNA Structure 5′ end 3′ end Two DNA chains • Complementary • Antiparallel 3′end 5′end

  12. CQ3: Below is one strand from part of the amelogenin gene. What is the nucleotide sequence of the other strand? 5’-CCCTGGGCTCT-3’ A: 3′ -ACTGTTAGATT-5′ B: 3′ -GGGACCCGAGA-5′ C: 5′ -GGGACCCGAGA-3′ D: 3′ -CCCTGGGCTCT-5′ E: 5′ -CCCTGGGCTCT-3′

  13. A T C G G A C T A T C G G A C T A T C G G A C T T A G C C T G A T A G C C T G A T A G C C T G A - - - - - - - - - - - - - - - - - T - A - G - A - C - T Copying DNA (Replication) DNA strands are separated - - - - - - - - Each single strand is used as a template to make a complementary strand Two identical DNA molecules are produced

  14. Enzymes Perform Replication Helicases unwind DNA double helix. Single Stranded Binding Proteins hold separated DNA strands apart. Primase makes a starting point (primer). DNA polymerase connects new complementary bases. Ligase attaches pieces together.

  15. Enzymes Perform Replication Replication fork

  16. CQ4: How would DNA replication be affected if ligase were not available? A: The template strands would not be able to separate. B: Replication would result in many small segments of DNA instead of a complete molecule. C: Complementary RNA would be produced but not complementary DNA. D: The DNA strands would separate but replication would not be able to start. E: The DNA strands produced by replication would not be complementary to the template strands.

  17. Amplifying DNA with PCR (Polymerase Chain Reaction) Thermal cycle Thermal cycle Thermal cycle Target region In 32 cycles at 100% efficiency, 1.07 billion copies of targeted DNA region are created

  18. CQ5: You need many copies of the amelogenin gene, which you will make using Polymerase Chain Reaction (PCR). You will need to follow the steps of replication. Which of the following would allow you to begin? A: Add short stretches of single stranded DNA complementary to the sequence at either end of the gene. B: Add DNA polymerase enzyme. C: Break the covalent bonds that hold the double helix together. D: Break the hydrogen bonds that hold the double helix together.

  19. CQ6: Which of the strands of DNA could act as a primer for the DNA sequence shown below? 5’-CCCTGGGCTCTGTAAATGTTTCTAAGTG-3’ 3’-GGGACCCGAGACATTTACAAAGATTCAC-5’ A: 3′ -ACTGTTAGA-5′ B: 3′ -AAATTTGGC-5′ C: 3′ -ATGCTTTGA-5′ D: 5′ -GGGACCCGA-3′ E: 5′ -CCCTGGGCT-3′

  20. Automated gels 110 bp 101 bp Amelog. MW

  21. CQ7: The blood left at the crime scene was from a male. Which of the following DNA profiles could have come from the suspect? A: B:

  22. CQ8: Is this enough to convict a suspect? A: Yes B: No

  23. Additional Markers ---TCAT--- ---TCAT--- • Same pair in suspect 2: Short Tandem Repeats (STRs) • Chromosomes 11 of suspect 1: • Different people have different numbers of repeats on their chromosomes

  24. Positions of other STR regions TPOX CSF1PO TH01 Each person is unique AMEL 24

  25. Druid Dracula: DNA testing • With kits just add DNA sample with primers for amelogenin (XY) different STR regions. • Amplify and electrophores. • Allele ladder shows all varieties in population.

  26. CQ9: What is the chance that someone might have 5 and 7 repeats for the STR THO1 just by accident? A: 1/200 B: 1/206 C: 1/600 D: 1/1200 E: 1/2600

  27. Hardman’s Arrest • Standard police work identified Matthew Hardman as a suspect. Preliminary DNA testing provided enough evidence to arrest Hardman on suspicion of murder. • During the arrest, a knife was found in his coat pocket. Subsequent DNA testing revealed two sources of DNA on the knife, one from Hardman and one matching the victim. The possibility of a random match was one in 73 million. • A search of Hardman’s dwelling produced magazines and evidence of accessing internet sites featuring how to become a vampire.  • Matthew Hardman was found guilty of murder on August 2, 2002, and sentenced to life imprisonment.

More Related