Discovering DNA: Structure, Replication, and the Journey of Genetic Understanding
This chapter delves into the groundbreaking history of DNA discovery, beginning with Mieschner’s identification of nucleic acids in 1869, followed by Levene's revelation that DNA is a polymer of nucleotides. Key experiments by Griffith, Avery, and the Hershey-Chase team demonstrate DNA's role in transformation and genetic information. Notable contributions from Chargaff, Franklin, and Watson-Crick elucidate DNA's helical structure and base-pairing rules. Finally, we explore the semi-conservative mechanism of DNA replication, emphasizing enzymatic processes that ensure accurate genetic transmission.
Discovering DNA: Structure, Replication, and the Journey of Genetic Understanding
E N D
Presentation Transcript
DNA Structure, Replication, and Organization Chapter 14
Discovery of DNA • Nucleic Acids were discovered in 1869 by Friedrich Mieschner as a substance contained within nuclei • 1929 Phoebus Levene discovered that DNA was a polymer of nucleotides • During the ’30s & 40’s proteins rather than DNA was thought to hold genetic information
Griffith Discovers Transformation • 1928 • Attempting to develop a vaccine • Isolated two strains of Streptococcus pneumoniae • Rough (R) strain was harmless • Smooth (S) strain was pathogenic
Transformation 1. Mice injected with live cells of harmless strain R. 2. Mice injected with live cells of killer strain S. 3. Mice injected with heat-killed S cells. 4. Mice injected with live R cells plus heat-killed S cells. Mice live. No live R cells in their blood. Mice die. Live S cells in their blood. Mice live. No live S cells in their blood. Mice die. Live S cells in their blood.
Transformation What happened in the fourth experiment? • The harmless R cells had been transformed by material from the dead S cells • Descendents of the transformed cells were also pathogenic • Why?
Oswald & Avery What is the transforming material? • Cell extracts treated with protein-digesting enzymes could still transform bacteria • Cell extracts treated with DNA-digesting enzymes lost their transforming ability • Concluded that DNA, not protein, transforms bacteria
Bacteriophages • Viruses that infect bacteria • Consist of protein and DNA • Inject their hereditary material into bacteria bacterial cell wall plasma membrane cytoplasm Figure 13.4bPage 219
Created labeled bacteriophages Radioactive sulfur – Labels Proteins Radioactive phosphorus – Labels Nucleic Acids Allowed labeled viruses to infect bacteria Asked: Where are the radioactive labels after infection? Hershey & Chase’s Experiments
What is DNA? • DNA is a Nucleic Acid • Polymer of Nucleotides • Each nucleotide consists of • Deoxyribose (5-carbon sugar) • Phosphate group • A nitrogen-containing base • Four bases • Adenine, Guanine, Thymine, Cytosine
Composition of DNA • Chargaff showed: • Amount of adenine relative to guanine differs among species • Amount of adenine always equals amount of thymine and amount of guanine always equals amount of cytosine A=T and G=C
Rosalind Franklin’s Work • Was an expert in X-ray crystallography • Used this technique to examine DNA fibers • Concluded that DNA was some sort of helix
Watson-Crick Model • DNA consists of two nucleotide strands: Double Helix • Strands run in opposite directions - Antiparallel • Strands are held together by hydrogen bonds between bases • A binds with T and C with G • The sides of the ladder are a sugar-phosphate backbone, while the “rungs” of the ladder are the bases
Base-pairing rule The four bases of DNA are: Adenine (A) Guanine (G) Thymine (T) Cytosine (C) Adenine always hydrogen bonds with Thymine (A-T) Guanine always hydrogen bonds with Cytosine (G-C) These bonding patterns are called base pairings (bp)
The pattern of base pairing is the mechanism by which DNA holds information. Humans have a > 6 billion of these base pairings Less than 5% of our DNA actually forms genes There about 30,000 genes encoded in our DNA, nearly half of these genes either have yet to be discovered or their function is unknown DNA is written out like this: CTCGAGGGGCCTAGACATTGCCCTCCAGAGAGAGCACCCAACACCCTCCAGGCTTGACCGGCCAGGGTGTCCCCTTCCTACCTTGGAGAGAGCAGCCCCAGGGCATCCTGCAGGGGGTGCTGGGACACCAGCTGGCCTTCAAGGTCTCTGCCTCCCTCCAGCCACCCCACTACACGCTGCTGGGATCCTGGA
DNA replication • Before mitosis and meiosis, all of the DNA in the cell must be copied or replicated • How does this happen?
How does DNA replicate? • Possibilities:
DNA Replication • The mechanism by which DNA is replicated is considered semi-conservative • Semi-conservative replication: Half of the original parent DNA molecule is conserved in each of the daughter molecules. • This allows for the parent DNA to serve as a template for generating the daughter DNA molecules • Half of the replicated DNA strand is “old” and the other half is “new”
new old old new DNA Replication • Semi-Conservative
Basepairing During Replication • Each old strand serves as a template for the new complementary strand
Enzymes Required for Replication • Helicase: “Melts” or opens up the double strand so that the DNA is single stranded • DNA polymerase: multiple types, responsible for the actual synthesis of DNA • Ligase: Joins together small newly synthesized pieces of DNA called Okazaki fragments • Primase: Adds an RNA primer so that DNA synthesis can begin
DNA Replication • DNA is synthesized 5’ to 3’ • Energy for synthesis comes from the removal of the two phosphates of the in coming nucleotide
DNA Replication • Since DNA is antiparallel, synthesis occurs in opposite directions • One strand in continuously synthesized - leading strand (5’3’) • The other is synthesized in short discontinuous strands - lagging strand (3’5’) • Because of this DNA synthesis is called Semidiscontinuous
Unwinding enzyme (helicase) Template for leading strand Primase 1 Helicase unwinds the DNA, and primases synthesize short RNA primers. RNA primers Overall direction of replication Template for lagging strand Replication fork Leading strand DNA polymerase RNA primers are used as starting points for the addition of DNA nucleotides by DNA polymerases. 2 RNA RNA DNA Lagging strand DNA polymerase Fig. 14-12a, p. 290
3 DNA unwinds further, and leading strand synthesis proceeds continuously, while a new primer is synthesized on the lagging strand template and extended by DNA polymerase. DNA polymerase Newly synthesized primer Primer being extended by DNA polymerase Another type of DNA polymerase removes the RNA primer, replacing it with DNA, leaving a nick between the newly synthesized segments. 4 Nick DNA polymerase Fig. 14-12b, p. 290
DNA ligase Nick is closed by DNA ligase. 5 DNA continues to unwind, and the synthesis cycle repeats as before: continuous synthesis of leading strand and synthesis of a new segment to be added to the lagging strand. 6 Lagging strand Leading strand DNA polymerase Newly synthesized primer Primer being extended by DNA polymerase Fig. 14-12c, p. 290
DNA Synthesis Begins at sites that act as replication origins Proceeds from the origins as two replication forks moving in opposite directions
DNA Replication: Fast & Accurate! • It takes E. coli <1 hour to copy 5 million base pairs in its single chromosome & divide to form 2 identical daughter cells • Human cell copies its 6 billion bases & divide into daughter cells in only few hours • Remarkably accurate • only ~1 error per 100 million bases • ~30 errors per cell cycle
DNA Repair • DNA polymerase enzymes • Recognize distorted regions caused by mispaired base pairs • Remove DNA section with mispaired base from the newly synthesized nucleotide chain • Resynthesize the section correctly, using original template chain as a guide