1 / 25

A Lot More Advanced Biotechnology Tools

A Lot More Advanced Biotechnology Tools. Sequencing. DNA Sequencing. Sanger method determine the base sequence of DNA based on replication dideoxynucleotides ddATP, ddGTP, ddTTP, ddCTP missing O for bonding of next nucleotide terminates the growing chain. DNA Sequencing. 1.

susanestrada
Télécharger la présentation

A Lot More Advanced Biotechnology Tools

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. A Lot More Advanced Biotechnology Tools Sequencing

  2. DNA Sequencing • Sanger method • determine the base sequence of DNA • based on replication • dideoxynucleotides • ddATP, ddGTP, ddTTP, ddCTP • missing O for bonding of nextnucleotide • terminates the growing chain

  3. DNA Sequencing 1 • Sanger method • synthesize complementary DNA strand in vitro • in each tube: • “normal” N-bases • dideoxy N-bases • ddA, ddC, ddG, ddT • DNA polymerase • primer • buffers & salt 2 3 4 2

  4. Reading the sequence • Load gel with sequences from ddA, ddT, ddC, ddG in separate lanes • read lanes manually & carefully • polyacrylamide gel

  5. 1978 | 1980 Fred Sanger This was his 2nd Nobel Prize!! • 1st was in 1958 for the structure of insulin

  6. Advancements to sequencing • Fluorescent tagging • no more radioactivity • all 4 bases in 1 lane • each base a different color • Automated reading

  7. Advancements to sequencing • Fluorescent tagging sequence data • Computer read & analyzed

  8. Advancements to sequencing • Capillary tube electrophoresis • no more pouring gels • higher capacity & faster Applied Biosystems, Inc (ABI) built an industry on these machines 384 lanes

  9. Big labs! • economy of scale PUBLIC • Joint Genome Institute (DOE) • MIT • Washington University of St. Louis • Baylor College of Medicine • Sanger Center (UK) PRIVATE • Celera Genomics

  10. Automated Sequencing machines • Really BIG labs!

  11. Human Genome Project • U.S government project • begun in 1990 • estimated to be a 15 year project • DOE & NIH • initiated by Jim Watson • led by Francis Collins • goal was to sequence entire human genome • 3 billion base pairs • Celera Genomics • Craig Venter challenged gov’t • would do it faster, cheaper • private company

  12. gov’t method Craig Venter’s method “map-based method” “shotgun method” 1. Cut DNA entire chromosome into small fragments and clone. 2. Sequence each segment & arrange based on overlapping nucleotide sequences. Different approaches • Cut DNA segment into fragments, arrange based on overlapping nucleotide sequences, and clone fragments. 2. Cut and clone into smaller fragments. 3. Assemble DNA sequence using overlapping sequences.

  13. Human Genome Project On June 26, 2001, HGP published the “working draft” of the DNA sequence of the human genome. Historic Event! • blueprint of a human • the potential to change science & medicine

  14. Sequence of 46 Human Chromosomes 3G of data 3 billion base pairs

  15. TACGCACATTTACGTACGCGGATGCCGCGACTATGATCACATAGACATGCTGTCAGCTCTAGTAGACTAGCTGACTCGACTAGCATGATCGATCAGCTACATGCTAGCACACYCGTACATCGATCCTGACATCGACCTGCTCGTACATGCTACTAGCTACTGACTCATGATCCAGATCACTGAAACCCTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACTGCTACTGATCTAGCTCAATCAAACTCTTTTTGCATCATGATACTAGACTAGCTGACTGATCATGACTCTGATCCCGTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACTGCTACTGATCTAGCTCAATCAAACTCTTTTTGCATCATGATACTAGACTAGCTGACTGATCATGACTCTGATCCCGTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACTTACGCACATTTACGTACGCGGATGCCGCGACTATGATCACATAGACATGCTGTCAGCTCTAGTAGACTAGCTGACTCGACTAGCATGATCGATCAGCTACATGCTAGCACACYCGTACATCGATCCTGACATCGACCTGCTCGTACATGCTACTAGCTACTGACTCATGATCCAGATCACTGAAACCCTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACTGCTACTGATCTAGCTCAATCAAACTCTTTTTGCATCATGATACTAGACTAGCTGACTGATCATGACTCTGATCCCGTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACTGCTACTGATCTAGCTCAATCAAACTCTTTTTGCATCATGATACTAGACTAGCTGACTGATCATGACTCTGATCCCGTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACT human genome3.2 billion bases

  16. Raw genome data

  17. NCBI GenBank Database of genetic sequences gathered from research Publicly available on Web!

  18. Organizing the data

  19. Maps of human genes… • Where the genes are… • mapping genes & their mutant alleles

  20. gene protein gene RNA polypeptide 1 gene polypeptide 2 polypeptide 3 Defining a gene… “Defining a gene is problematic because… one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there are many other complications.” – Elizabeth Pennisi, Science 2003

  21. And we didn’t stop there…

  22. The Progress 122+ bacterial genomes first metazoan complete (flatworm) first eukaryote complete (yeast) 17 eukaryotic genomes complete or near completion including Homo sapiens, mouse and fruit fly First 2 bacterial genomes complete # of DNA base pairs (billions) in GenBank Official “15 year” Human Genome Project: 1990-2003. Data from NCBI and TIGR (www.ncbi.nlm.nih.gov and www.tigr.org )

  23. How does the human genome stack up?

  24. What have we found? • When you go looking…

  25. …you will certainly find something!

More Related