PREETI MISRA Advisor: Dr. HAIXU TANG SCHOOL OF INFORMATICS - INDIANA UNIVERSITY

2. Overview Background Tandem repeats Methodology Results Conclusions References

3. Background An array of consecutive repeats Repeating pattern or consensus = 5 Total repeat length = 25 3 main types of tandem repeats Microsatellites -- 1-5 bp repeating pattern Minisatellites -- 6-50 bp repeating pattern Large tandem -- greater than 50 bp repeating pattern

4. Significance Use tandem repeats to determine whether 2 DNA samples belong to same person or not Uses � Forensic use Paternity testing

5. Mechanism of tandem duplication Unequal recombination is the major known mechanism for the formation of large tandem repeats Image has been downloaded from http://hc.ims.u okyo.ac.jp/JSBi/journal/GIW02/GIW02F010/GIW02F010.html

6. Tandem gene duplication Benefits � New functions arise. Responsible for the evolution of gene clusters Example � Zinc finger genes in mammalian genes

7. Purpose Large tandem repeats are commonly found in eukaryotes � humans have 1.684 % and chimpanzees have 1.525% To date the large tandem duplication and find the relationship between various characteristics of long tandem repeats and corresponding evolutionary time 8 genomes � 3 primates, 2 rodents , dog, chicken and puffer fish were analyzed

8. Methodology Identification Tandem repeat finder (TRF) for identification of large tandem repeats Distance computation Jukes � Cantor distance model to find distance between two repeats Transformation Transform the above computed distance into evolutionary time

9. Tandem Repeat Finder STRING, Mreps and TRF TRAP: T.Jose, P. Sobreira, A.Durham and A.Gruber TRF can be downloaded at http://tandem.bu.edu/trf/trf.html Starting and ending positions of tandem repeat was present Number of repetitions A%, C%, G%, T% percentage of bases in the tandem repeat Length of the consensus word (only the first 10 bases)

10. Tandem Repeat Finder Tandem repeat finder outline : Tandem repeat finder program has 2 main components � detection and analysis Detection - Finds candidate tandem repeats Analysis - Produces an alignment for each candidate and statistics about the alignment

11. Tandem Repeat Finder Large tandem repeats were extracted Results of TRF � 1 5 100 0 50 20 40 20 20 1.92 GATCC GATCCGATCCGATCCGATCCGATCC GATCC - period or consensus GATCCGATCCGATCCGATCCGATCC - repeat 1 - indices 5 - consensus or period size 100 - percent matches 0 - percent indels 50 - score 20 - % of A 40 - % of C 1.92 - entropy

12. DNA Sequence Evolution Model For Dating

13. Computing divergence of tandem repeating units � Repeat identity - each repeat is compared with other repeats and maximum similarity/identity is considered GATCC GATCC|GATCC|GATCC|GATCC|GATCC Dating tandem duplications

14. Jukes-Cantor model Computes the distance between 2 repeats All bases occur with equal probability, i.e. p = 0.25 for A, T, G and C All possible base substitutions are equally likely as follows - A ? G, A ? C, A ? T, G ? T

15. Jukes-Cantor model m = no. of mutations n = length of sequence D =�-3/4 ln(1- 4/3 m/n) D = Distance between two repeats Ex- Observed mismatches at 25% of the sites, then Jukes Cantor model predicts the distance between two repeat is 0.304

16. Estimating the evolutionary time Transforming the computed distance (D) between two repeats into evolutionary time Neutral mutation rate in mammals is nearly 1.25 * 10-9 per year per site Time (T) = D / 1.25 * 10-9 years ago Ex- D = 0.1 T = 0.1 / 1.25 * 10-9 = 80 million years ago

17. Material and Method Material The genome files were downloaded from UCSC site http://hgdownload.cse.ucsc.edu/downloads.html The tandem repeat finder and stretcher software were downloaded Procedure Extraction of large tandem repeats with the help of tandem repeat finder Calculation of similarities between tandem repeats using stretcher Computation of the distance using Jukes-Cantor model Transformation of distance to the evolutionary time

18. Tree of life

19. Recap � period & repeat

20. Results

21. Results

22. Total number of repeats

23. Total number of period or consensus

24. Results of repeat length

25. % Repeat results

26. Dating tandem repeats

27. Tree of life

28. Conclusions Primates (human, chimpanzee and macaque) have highest number of long tandem repeat duplications Dating peak is prominent in human, chimpanzee and macaque, especially between 80-120 million years ago Tandem repeat results follow a pattern which is similar to the divergence as shown in the tree of life Dog, rat and mouse show steady increase in number of tandem duplications but burst is negligible between 80-120 million years ago Human has highest number of duplications among all studied genomes

29. Acknowledgements Advisor � Dr. Haixu Tang School of Informatics Members of Computational Omics Lab Parents, Rajen & Rajeev Prasanta

30. References Methods for reconstructing the history of tandem repeats and their application to the human genome Authors: Jaitly D, Kearney P , Lin G, Ma B A Survey on Algorithmic Aspects of Tandem Repeats Evolution. Authors: E. Rivals Topological Rearrangements and Local Search Method for Tandem Duplication Trees Authors: Denis Bertrand and Olivier Gascuel Greedy method for inferring tandem duplication history Authors: Louxin Zhang Bin Ma Lusheng Wang and Ying Xu A fast and accurate distance algorithm to reconstruct tandem duplication trees Authors: Elemento O. and Gascuel O Tandem repeats finder: a program to analyze DNA sequences Author: Gary Benson

31.