1 / 48

Evolution of biological regulatory networks

J. Demongeot AGIM, CNRS/UJF Grenoble. Evolution of biological regulatory networks. IMMUNETWORKS: ThE ROLE OF CIRCUITS. Robustness Role of circuits Role of n-switches Role of microRNAs Role of viruses Don’t forget resilience JD, E. Goles , M. Morvan, M. Noual & S. Sené

tamal
Télécharger la présentation

Evolution of biological regulatory networks

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Valparaiso J. Demongeot AGIM, CNRS/UJF Grenoble Evolution of biologicalregulatory networks

  2. Valparaiso IMMUNETWORKS: ThE ROLE OF CIRCUITS

  3. Valparaiso • Robustness • Role of circuits • Role of n-switches • Role of microRNAs • Role of viruses • Don’tforgetresilience • JD, E. Goles, M. Morvan, M. Noual & S. Sené • Attraction Basins as Gauges of EnvironmentalRobustness in BiologicalComplex Systems. • PloS ONE, 5, e11793(2010). • Don’tforgetresistance • JJD & S. Sené • The singular power of the environment on nonlinearHopfield networks. • In : CMSB’11, • ACM Proceedings, New York, 55-64 (2011).

  4. Valparaiso RAG control network C. Georgescu et al. PNAS 2008

  5. Valparaiso V(D)J Recombination Mechanism TCRα Vn C Jm Germinal Configuration V(D)J Recombinase RAG (RecombinationActivatinggene) V-J Réarrangement TREC T-cell-ReceptorExcisionalCirclegene N. Pasqual et al. J. Exp. Medicine,196, 1163-1174(2002) T.P. Baum et al. BMC Bioinformatics, 7, 224-228(2006) F. Thuderoz et al. PLoSComp. Biol.,6, e1000682(2010)

  6. Valparaiso V and J gene use: Experimental quantifications in BalbC mouse Diversity of the TCR αCombinatorialRepertoire Peripheral Proximal J Genes Proximal V Genes TRAV 21 Distal V Genes Distal J Genes TRAV 1 TRAV14-1 TRAV14-2 TRAV14-3 TRAV14-D1 TRAV14-D2 TRAV14-D3

  7. Valparaiso Negative 6 Negative 2

  8. Valparaiso Runx1 R Runx1 RAG-1 TCRa JD et al. Journal of TheoreticalBiology280, 19-33 (2011) F. Thuderoz et al. PloSComp. Biol. 6(2010) T.P. Baum et al. NucleicAcidsRes. 32, 51-54(2004).

  9. Valparaiso Noual, JD, Sené DAM (accepted) Parallel iterations

  10. Valparaiso l= 3 × r/ 2

  11. Valparaiso Positive circuits Negative circuits

  12. Valparaiso Frustration

  13. Valparaiso

  14. Valparaiso

  15. Valparaiso NOT CODING GENOME: The ROLE of MICRORNAS

  16. Valparaiso Overview of mRNA and miRNA Processing CATG GTAC Non coding DNA Coding DNA pri-miRNA GUAC Drosha Enzyme pre-miRNA hairpin Exportine-5 mRNA RISC miRNA tRNAs mRNA/miRNApairing RNA binding oligopeptide

  17. Valparaiso H.I. Suzuki et al., J. Mol. Med. 2010 targettRNA mitochondrion

  18. Valparaiso

  19. Valparaiso Mitomirs A U G U U G A U A U A G G C G A U G U U C G 5’ GAUUAGGGUGCUUAGCUGUUAA 3’ MIR 1977 (A. Henrion-Caude, Mirifix, PLoS ONE 2011, JD et al. ECAL, MIT Press 2011)

  20. 5’ AUCUGGUUCUUACUUCAGGGCmitomir 10 Central 116 RARYGGUACU RRYUUCRARYU tRNALewin AUCUGGUUCU UACUUCAGGACmitomir 12 CSB D 353 mitomir 10 E. SbisaGene 205 (1997) mitomir 12 P. Cui BMC Genomics 8(2007) Valparaiso NoTcoding mitochondrial DNA R = A or G; Y = U or C

  21. Valparaiso The ROLE of viruses

  22. Anatomie virale

  23. ‘Patient Zero H1N1’ (5 ans) Edgar Hernandez

  24. Valparaiso

  25. Valparaiso

  26. Valparaiso

  27. Valparaiso GENERAL ARCHITECTURE 10 + Negative circuit of size 3 +

  28. miRinhibition withparallelupdating miR G1 G1 miR miR G1 G2 G2 G2 G3 G3 G3 Valparaiso Negative 3-switchPositive circuits Persistence of rhythm in case of weak inhibition

  29. Valparaiso NEUROGENETWORKS

  30. Valparaiso

  31. Valparaiso

  32. Valparaiso

  33. Valparaiso ROBUSTNESS

  34. Valparaiso

  35. Valparaiso

  36. Valparaiso

  37. Valparaiso

  38. + - X1 X2 . . . Xn -1 -1 Xi Valparaiso [27] M. Cosnard, E. Goles, Discrete states neural networks and energies, Neural Networks 10 (1997) 327-34

  39. Valparaiso

  40. Valparaiso Engrailed network

  41. Valparaiso

  42. Valparaiso

  43. Coherent feed-forward double path p53 Double positive loop miRNA 34 Valparaiso Cell cycle control mitomiRs ParallelSequential p27, Cdk2, pCyCE Cdk2, CyCE Cdk2, miRNA159, pCycA Cdk2, CycA Cdk2, Rbp-E2F, Rb-E2F, E2F, Rbp, Rb L. He et al. Nature 447, 1130-1134 (2007)

  44. miRNA159=1 Parallel updating Valparaiso

  45. Valparaiso

  46. Conclusion Valparaiso • Robustness • Role of circuits • Role of n-switches • Role of microRNAs • Role of viruses • Don’tforgetresilience • JD, E. Goles, M. Morvan, M. Noual & S. Sené • Attraction Basins as Gauges of EnvironmentalRobustness in BiologicalComplex Systems. • PloS ONE, 5, e11793(2010). • Don’tforgetresistance • JJD & S. Sené • The singular power of the environment on nonlinearHopfield networks. • In : CMSB’11, • ACM Proceedings, New York, 55-64 (2011).

More Related