170 likes | 319 Vues
Analyzing nuclear and mitochondrial genetic diversity in the Alaska Blackfish ( Dallia pectoralis ). Rachel DeWilde University of Alaska Fairbanks EPSCoR All-Hands Meeting 2011. Overview. The Alaska Blackfish Genetic Analysis Sequencing Mitochondrial DNA
E N D
Analyzing nuclear and mitochondrial genetic diversity in the Alaska Blackfish (Dallia pectoralis) Rachel DeWilde University of Alaska Fairbanks EPSCoR All-Hands Meeting 2011
Overview • The Alaska Blackfish • Genetic Analysis • Sequencing Mitochondrial DNA • Microsatellites • Genotyping Microsatellites • 454 sequencing • Developing primer candidates
The Alaska Blackfish Fresh water fish Poor swimmers Short life span Prefer shallow vegetated habitats
Geographic Barriers • Brooks range • Yukon River • Tanana River
Collection Localities North Slope: 2 Interior: 4 Coast: 8 Russia: 3 =17 Sampling sites 24 24 sampling locations
Interior Coast Russia North Slope Sequencing mtDNA Coast Naknek: 10 Galena: 17 Galena Coast
Microsatellites AGTA CCGTACTGAGCGTACTGAG AGTAGTAGTAGTAGT ACGGCAAATCGTATATTCGA GCG Biparentally inherited Mutation rate Saturate the genome
ACACAC AC ACACACACDinucleotideACACACACACACACA ACGACG ACG ACGACGACG Trinucleotide ACGACGACGACGA GTACGT ACGT ACGTACGTTetranucleotideACGTACGTACG
Genotyping Microsatellites Dinucleotide differences: North Slope & Russia 1 repeat North Slope & Interior 3 repeats North Slope & Galena 5 repeats [at most]
Developing Microsatellites Using 454 Sequencing Initial study: 2009 13 polymorphic microsatellite loci 7,000 microsatellites -66% -33% =10-100 microsatellites
Primer Design Process 1. Extract DNA from one individual 2. Check DNA quality 3. Export to facility 4. Filter sequence results 1. Fresh Fairbanks Fish 2. Nanodrop 3. Duke genome sequencing and analysis facility 4. Msatcommander
Duke Results • 123,109 microsatellites Msatcommander search
6 repeats 12 repeats 247 microsatellites 62 primers 27 candidate primers 65 Microsatellites 10 primers 5 candidate primers
27 six repeat primer candidatesand5 twelve repeat primer candidates
Interior North Slope N Interior North Slope Coast Galena Interior North Slope Coast Galena N 12x trial L CLC8X B74AX B2BSZ Interior North Slope Coast Galena N BWBSP B2BSZ CGIUZ Coast Galena N Interior North Slope Coast Galena N L
Future Research Galena sequencing 6 repeat microsatellites 12 repeat microsatellites Candidate primer genotyping
Hosted by: the Lopez lab • MathewCampbell • Mentor • Andres Lopez • Advisor Acknowledgements Funded by: EPSCoR Partial funding from: • The Center for Research Services • INBRE IDea Network for Biomedical Research Questions