By Ahmed Kamal , PhD

1. PCR And PCR Primer Design By Ahmed Kamal, PhD Molecular Biology & Biotechnology unit (ARC)

2. Introduction to Bio chemistry Of Nucleic Acids PCR And PCR Primer Design

3. Structure of DNA molecule showing the two strands connected by hydrogen bonding between adjacent bases PCR And PCR Primer Design

4. The general structure of nucleotides. PCR And PCR Primer Design

5. Pentoses The chemical structure of pentose which contains five carbon atoms, labeled as C1' to C5'. PCR And PCR Primer Design

6. Bases There are five different bases, each is denoted by a single letter: Adenine (A), Cytosine (C), Guanine (G), Thymine (T), and Uracil (U). • A, C, G and T exist in DNA; • A, C, Gand U exist in RNA. Their chemical structures are shown in the following figure. A and G contain a pair of fused rings, classified as purines. C, T, and U contain only one ring, classified as pyrimidines PCR And PCR Primer Design

7. Chemical structures of bases in DNA and RNA. The red "N" (N9 of purines and N1 of pyrimidines) is connected to the pentose. PCR And PCR Primer Design

8. Schematic drawing of DNA's two strands PCR And PCR Primer Design

9. Computer model of base pairing in DNA: In a normal DNA molecule, adenine (A) is paired with thymine (T), cytosine (C) is paired with guanine (G). The uracil (U) of RNA can also pair with adenine (A), since U differs from T by only a methyl group located on the other side of hydrogen bonding. PCR And PCR Primer Design

10. Polymerase Chain Reaction (PCR) The PCRis a powerful method to amplify specific sequences of DNA from a large complex mixture of DNA The specificity of PCR is determined by the specificity of the PCR primers. if your primers bind to more than one locus, more than one segment of DNA will be amplified. you can design specific PCR primers to amplify a single locus from an entire genome. PCR And PCR Primer Design

11. The cycling reactions : There are three major steps in the PCR, which are repeated for 30 or 40 cycles. 1) Denaturation at 94°C : During the denaturation, the double strand melts open to single stranded DNA, all enzymatic reactions stop. 2) Annealing at (Ta)°C : Hydrogen bonds are constantly formed and broken between the single stranded primer and the single stranded template. 3) Extension at 72°C : This is the ideal working temperature for the polymerase. The bases (complementary to the template) are coupled to the primer on the 3' side PCR And PCR Primer Design

12. PCR And PCR Primer Design

13. PCR methods PCR And PCR Primer Design

14. Multiplex-PCR • 2 or more unique targets of DNA sequences in the same specimen are amplified simultaneously. One can be use as control to verify the integrity of PCR. Can be used for mutational analysis and identification of pathogens. PCR And PCR Primer Design

15. Inverse PCR • for amplification of regions flanking a known sequence. DNA is digested, the desired fragment is circularise by ligation, then PCR using primer complementary to the known sequence extending outwards. PCR And PCR Primer Design

16. Nested PCR means that two pairs of PCR primers were used for a single locus. The first pair amplified the locus as seen in any PCR experiment. The second pair of primers (nested primers) bind within the first PCR product and produce a second PCR product that will be shorter than the first one. The logic behind this strategy is that if the wrong locus were amplified by mistake, the probability is very low that it would also be amplified a second time by a second pair of primers. When a complete genome sequence is known, it is easier to be sure you will not amplify the wrong locus but since few of the world's genomes have been sequenced completely, nested primers will continue to be an important control for many experiments. PCR And PCR Primer Design

17. RT-PCR (reverse transcriptase) using RNA-directed DNA polymerase to synthesize cDNAs which is then used for PCR and is extremely sensitive for detecting the expression of a specific sequence in a tissue or cells PCR And PCR Primer Design

18. Immuno-Capture PRC [IC-PCR] PCR And PCR Primer Design

19. Recusive PCR - Used to synthesise genes. Oligos used are complementary to stretches of a gene (>80 bases), alternately to the sense and to the antisense strands with ends overlapping (~20 bases). Design of the oligo avoiding homologous sequence (>8) is crucial to the success of this method. PCR And PCR Primer Design

20. M A B C H M L1 L2 L3 L4 MYSV 720bp SCMV BYDV • PCR result for bulk samples tested for MYSV . A, B and C are 3 different Bulks M: DNA marker. H: Healthy plant control. L1: sample infected with BYDV-PAV. L2: sample infected with MYSV. L3: sample infected with SCMV. L4: Multiplex PCR product for the 3 viruses. PCR And PCR Primer Design

21. PCR Primer Design PCR And PCR Primer Design

22. Factors controlling the primer design The annealing Temperature Primer Length GC Ratio Primer specificty PCR And PCR Primer Design

23. Annealing Temperature and Primer Design Primer length and sequence are of critical importance in designing the parameters of a successful amplification The melting temperature (Tm) of a NA duplex increases both with its length, and with increasing (G+C) content A simple formula for calculation of the Tm is: Tm = 4(G + C) + 2(A + T) oC One should aim at using an annealing temperature (Ta) about 5 oC below the lowest Tm of the pair of primers to be used PCR And PCR Primer Design

24. Primer Length 17-mer or longer (up to 30-mer) primers are routinely used for amplification from genomic DNA of animals and/or plants. Too long a primer length may mean that even high annealing temperatures are not enough to prevent mismatch pairing and non-specific priming. GC Ratio Must be not less than 40% PCR And PCR Primer Design

25. How to design PCR primers 181 taaaacccggggtcggtgtggtgttcggtcataagctgcattgcgaaccactagtcgccg 241 tttttcgtgtgcatcgcgtattcacggcATGgggcgtttgacctccggcgtcgggacggcg 301 gccctgctagttgtcgcggtgggactccgcgtcgtctgcgccaaatacgccttagcagac 361 ccctcgcttaagatggccgatcccaatcgatttcgcgggaagaaccttccggttttggac 421 *********************************************************************************** ********************************************************************************** 1261 gcccccgccgcccccagcaacccgggcctgatcatcggcgcgctggccggcagtaccctg 1321 gcggcgctggtcatcggcggtattgcgttttgggtacgccgccgcgctcagatggccccc 1381 aagcgcctacgtctcccccacatccgggatgacgacgcgcccccctcgcaccagccattg 1441 ttttacTAG PCR And PCR Primer Design

26. To design the forward primer: The forward primer position: CTA GTC GCC GTT TTT CGT G The primer length:19 bp G/C Ratio: ~ 52.6 % To calculate the Tm: Tm = 4(G + C) + 2(A + T) oC Tm = 4(10) + 2(9) oC Tm = 58 oC TheAnnealing temp. Ta = 53 oC PCR And PCR Primer Design

27. Three steps to design the reverse primer: AGC AAC CCG GGC CTG ATC 1- Select the position: 2- Find the complementary sequence: TCG TTG GGC CCG GAC TAG 3- Find the reverse of the complementary sequence: The reverse primer: GAT CAG GCC CGG GTT GCT G/C Ratio: ~ 66.5 % The primer length:18 bp To calculate the Tm: Tm = 4(G + C) + 2(A + T) oC Tm = 4(12) + 2(6) oC Tm = 60 oC TheAnnealing temp. Ta = 55 oC PCR And PCR Primer Design

28. Analysis of the two primers Using computer software The main three points must be taken in the consideration are: 1- Self complementarity 2- Mispriming (primer Pairing) 3- Mismatching PCR And PCR Primer Design

29. THANKS