1 / 14

Cold Tolerance in Vaccinium corymbosum

Cold Tolerance in Vaccinium corymbosum. Shamita Punjabi Lab Methods in Genomics BIO 343 Davidson College. Starting point: CBF genes Polashock et al (2010). The CBF (C-repeat binding factor) genes have a host of downstream targets that help plants acclimate to the cold

teague
Télécharger la présentation

Cold Tolerance in Vaccinium corymbosum

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Cold Tolerance in Vacciniumcorymbosum ShamitaPunjabi Lab Methods in Genomics BIO 343 Davidson College

  2. Starting point: CBF genesPolashock et al (2010) • The CBF (C-repeat binding factor) genes have a host of downstream targets that help plants acclimate to the cold • CBF genes are found in many species and are therefore a good target for understanding how cold acclimation can occur in a variety of plants

  3. CBFs and COR genes in other species Cold Acclimation/Freezing Tolerance in BlueberriesPolashock et al (2010)-COR6.6-COR78-COR15A etc.. Frost Tolerance in Temperate CerealsGaliba et al (2009)-FR2-TaCBF14-TaCBF15 Cold Tolerance in Eucalyptus SpeciesNavarro et al (2009)-EguCBF1c-EguCBF1d Cold Tolerance signaling in ArabidopsisLissarre et al, 2010-ICE1-ICE2Zhou et al, 2010 -SIZ1

  4. Research Scheme • Choose at least 1 CBF gene and 1 other frost tolerance gene to find in blueberry • Obtained mRNA sequences for the EguCBF1c in Eucalyptus, TaCBF14 in common wheat and ICE1 and SIZ1 in Arabidopsis from NCBI • Use tBLASTx in Vaccinium Database to find matches of mRNA sequences to amino acid sequences of blueberry scaffolds • Submit best scaffolds to SSR database and choose primers based on vicinity to gene matches on scaffold • Ultimately, devise a schematic pathway for activation of cold tolerance genes in blueberry • Links to Sequences for all genes used are provided on the Wiki

  5. Primers from SSR SearchEguCBF1c & TaCBF14 3 Primer Matches on Scaffold 00009 (~488,000 bp) E score = 2e-17 • Forward Primer: AGTTCTAAACCGATTGTGCGTT Reverse Primer: AATTCCAACCTAACTGCCAGAA TG 10x @ 479,956 bp, Product: 291 bp • Forward Primer: TCTCTCTCAGATCTCTGATCCGT Reverse Primer: AAAGCAAGAAGAGAAATGGTGGTCT 5x @ 479,466 bp, Product: 110 bp • Forward Primer: AATCTGCAAATCTCCATCACCTReverse Primer: TCCTAAAAACCAAAGCATGTCCCT 11x @ 463,925 bp, Product: 226 bp

  6. Primers from SSR SearchICE1 3 Primer Matches on Scaffold 00051 (~55,000 - 60,000 bp)  E score = 4e-80 • Forward Primer: CGCATCTTTACTCCACTAACCC Reverse Primer: AATCCCTGCTGTGTATCTTGGT TC 5x @ 55,088 bp, Product: 127 bp • Forward Primer: GTGGGGAGCAAACTCACTAATC Reverse Primer: AATAACAAAAACTCGCTCTCGC CA 5x @ 67,058 bp, Product: 186 bp • Forward Primer: GAGAAGTGAAGGAATGGAGGTG Reverse Primer: CGAAATGGGTTCACTCTCTACCTGT 4x @ 60,104 bp, Product: 259 bp

  7. Primers from SSR SearchSIZ1 3 Primer Matches on Scaffold 00717 (~85,000 - 107,000 bp)  E score = 0.0 • Forward Primer: AAGCCGCATATTAGAGCGTATC Reverse Primer: CCTCCCTCCTCTCTCTCTCTCT AG 21x @ 86,562 bp, Product: 300 bp • Forward Primer: ATTGCAATCTTGCACAGAGAGA Reverse Primer: CTACATAGGATACGCATTGGCA AG 13x @ 86,761 bp, Product: 279 bp • Forward Primer: CATTTGTACCCCCTCAAGTAGC Reverse Primer: TTTCCCTAGTGGTGAAGTGTGA GA 6x @ 107,162 bp, Product: 157 bp

  8. Phospholipid Signaling Pathway • Byeong-ha Lee et al used microarrays to find genes induced and repressed in cold environments • Phospholipid signaling is one of many pathways is affected by CBF transcription factors • Early induced genes: IP5PII and ADTGK1 • Late induced genes: IPK2a • KEGG Map for “phosphatidylinositol signaling” includes all of these genes

  9. Primers from SSR Search IP5PII (3.1.3.56) 3 Primer Matches on Scaffold 00661 (~93,000-105,000) E score = e-154 • Forward Primer: GATTCGAACGGCAGTATAAACC Reverse Primer: GCCCTTATCAATCTCCAAATGA AT 6x @ 106,789, Product: 222 bp • Forward Primer: ATGGAGTACCAAGGAAAAACGA Reverse Primer: CCATTTTTATCGGGGTGAGTAA TC 13x @ 81,787, Product: 246 bp • Forward Primer: TCTCTTCTACTGTCAGAGGCCC Reverse Primer: CACTCTGTTTGGAAAATGTGGA ATA 5x @ 86,548, Product: 231 bp

  10. Primers from SSR SearchATDGK1 (2.7.1.107) 3 Primer Matches on Scaffold 00019 (~355,000-360,000) E score = 0.0 • Forward Primer: CTAGCCTACCAACTACCTCCGA Reverse Primer: GGATTGCTTCTCTGTTTCTGCT AG 7x @ 352,411, Product: 214 bp • Forward Primer: AGCAGAAACAGAGAAGCAATCC Reverse Primer: CAAGGCAAACCCTAGAGAGAGA CT 11x @ 352,582, Product: 143 bp • Forward Primer: TTGAACATGCTCTTGAATCCTG Reverse Primer: TACGTGAGTATCATCCACAGCC AATA 4x @ 355,495, Product: 131 bp

  11. Primers from SSR SearchIPK2a (2.7.1.107) 4 Primer Matches on Scaffold 00135 (~2,000-3,000)E score = 4e-81 • Forward Primer: AATCAATCAGTTGACATGCGTC Reverse Primer: GCTTAAAGCTTAACAAGCCCAA CT 5x @ 7,764, Product: 197 bp • Forward Primer: ATCTAAATGTTTAATCGGGGGC Reverse Primer: ATCTAGGGAGACTGTTGGGGAT TG 6x @ 17,950, Product: 143 bp • Forward Primer: CCAATGCTGCTTCACTGTACTC Reverse Primer: TACTTGTCGGTTGCAGATTCAC AAAC 3x @ 7,124, Product: 229 bp • Forward Primer: ACCCATCCGAGGTATGTTACAG Reverse Primer: AAAGATTAAAGGCGGATAAGGC TTCGG 3x @ 791, Product: 108 bp

  12. KEGG Map for Phosphatidylinositol signaling pathway

  13. Rough Scheme of Blueberry Cold Response Pathway (Sumoylation) SIZ1 IPK2a IP5PII COLD! ICE1 CBF ADTGK1 Primers via SSR search have been provided for all subjects above

More Related