1 / 1

rs31416165

A. rs31416165. rs30796712. rs31415340. Pbx1*(75 bp) + + + + + - + + + + - Uninduced PRDM9 Cst - + - - - - - - - - - Induced PRDM9 Cst - - + + + + - - - - - Pbx1 cold - - - + - - - - + - -

thelma
Télécharger la présentation

rs31416165

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. A rs31416165 rs30796712 rs31415340 Pbx1*(75 bp) + + + + + - + + + + - Uninduced PRDM9Cst - + - - - - - - - - - Induced PRDM9Cst - - + + + + - - - - - Pbx1 cold - - - + - - - - + - - Non-competitor DNA - - - - + - - - - + - Uninduced PRDM9Dom2 - - - - - - + - - - - Induced PRDM9Dom2 - - - - - - - + + + + DNE QDK QVK ANQ AVQ QNK QDQ B D Pbx1* (75 bp) + + + + + + Induced PRDM9Dom2 + + + + + + Competitor (bp) - 75 29 31 33 34 Fraction shifted 0.02 0.02 0.03 0.02 0.03 0.0 0.02 0.34 0.03 0.28 0.0 C D Fraction shifted 0.13 0.01 0.06 0.06 0.06 0.03 QDK QVK AVQ AVQ QHQ Pbx1(34 bp)GAGAACTTACAAAGGTAGGACGTAAATGGAGTGT Inferred motif PRDM9Dom2ZnF

More Related