1 / 1

Investigating PRDM9 Variants: Pbx1 and DNA Interaction Dynamics

This study analyzes the interactions of Pbx1 with different PRDM9 variants using DNA competition assays. We explore the binding dynamics under uninduced and induced states, specifically examining the effects of PRDM9Cst and PRDM9Dom2. We present data indicating shifts in DNA fraction binding and inferred motifs related to PRDM9Dom2's zinc finger function. The findings enhance our understanding of Pbx1's role in genomic regulation and PRDM9's influence on DNA accessibility, offering insights for future genetic research.

thelma
Télécharger la présentation

Investigating PRDM9 Variants: Pbx1 and DNA Interaction Dynamics

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. A rs31416165 rs30796712 rs31415340 Pbx1*(75 bp) + + + + + - + + + + - Uninduced PRDM9Cst - + - - - - - - - - - Induced PRDM9Cst - - + + + + - - - - - Pbx1 cold - - - + - - - - + - - Non-competitor DNA - - - - + - - - - + - Uninduced PRDM9Dom2 - - - - - - + - - - - Induced PRDM9Dom2 - - - - - - - + + + + DNE QDK QVK ANQ AVQ QNK QDQ B D Pbx1* (75 bp) + + + + + + Induced PRDM9Dom2 + + + + + + Competitor (bp) - 75 29 31 33 34 Fraction shifted 0.02 0.02 0.03 0.02 0.03 0.0 0.02 0.34 0.03 0.28 0.0 C D Fraction shifted 0.13 0.01 0.06 0.06 0.06 0.03 QDK QVK AVQ AVQ QHQ Pbx1(34 bp)GAGAACTTACAAAGGTAGGACGTAAATGGAGTGT Inferred motif PRDM9Dom2ZnF

More Related