ulani
Uploaded by
19 SLIDES
354 VUES
190LIKES

Protocol continue ..

DESCRIPTION

Protocol continue . Process overview. Postfixation. After RT, Wash cells 2x with DEPC-PBS-T Post- since cells were already fixed with formaldehyde when placed on slides

1 / 19

Download Presentation
Télécharger la présentation

Protocol continue ..

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Protocolcontinue..

  2. Process overview

  3. Postfixation • After RT, Wash cells 2x with DEPC-PBS-T • Post- since cells were already fixed with formaldehyde when placed on slides • Postfixation is an important step that cross links novel cDNA strand through 5’ phosphateto adjacent chemical groups of proteins (locks the cDNA in place). • Use 3% formaldehyde in DEPC-PBS to fix cells for 10 min. in RT- prepared and frozeyesterday • Wash cells twice with DEPC-PBS-T – leave the second washing buffer inside !

  4. Process overview Degradation of RNA is necessary to leave “exposed” cDNA for padlock binding In double mRNA:cDNA formation, padlock probe can not bind RNaseH is (as Rnase) enzyme, that degrades RNA in double stranded heteroduplexes

  5. mRNA degradation and ligation Padlock probe ligation (forming a circle) Is executed by a ligase. Ligase can join two DNA molecules (padlock arms) into one. It need 3’ OH and5’ phosphate end to catalyze the reaction

  6. mRNA degradation and padlock ligation - PROTOCOL Incubate the reaction mix at 37°C (appropriate temperature for RNASE) for 30 min, followed by 45 °C (appropriate temperature for Ligase) for 45 min.

  7. mRNA degradation and padlock ligation - PROTOCOL

  8. Exo (end)nucleolysis After ligation, padlock probe is copied(amplified) ~1000 times by enzyme, Phi 29 polymerase. Enzyme has 2 activities The enzyme can cleave free 3’ end of the cDNA And when it reaches a padlock probe, ituses it a template to start amplification. Similar process to RT Primer – cDNA primer Template – padlock probe mRNA Amplification proceeds according to ROLLING CIRCLE AMPLIFICATION MODEL

  9. Rolling circle amplification

  10. Randomcoiling <1 mm It is easytosee a ”Big” DNA ball ratherthan small  [>1 mM] Signal amplificationthrough rollingcircleamplification (RCA) padlock probe primer This long DNA threadwillspontanously form a DNA ball dueto DNA interaction

  11. RCA- PROTOCOL Incubate the reaction mix at 37°C for one hour

  12. Randomcoiling <1 mm [>1 mM] Detection 1000 repeats – 45 mm [10 nM] At the end, youput short ”detectionoligonucleotides” ~20bp long, that bind to a ballduetotheircomplementarity

  13. Understanding the sandwich  • Padlock probe used a template to make.. • Long amplified molecule – cDNA, complementary to a padlock probe • Detection oligo has a same sequence as a reporter sequences of the padlock = it is complementary to your long amplified molecule Padlock Padlock cDNA Short Detection Oligo

  14. 5’ AGCCTCGCCTTTGCCTTCCTTTTACGACCTCAATGCTGCTGCTGTACTACTCTTCGCCCCGCGAGCACAG 3’ 5’ AGCCTCGCCTTTGCCTTCCTTTTACGACCTCAATGCTGCTGCTGTACTACTCTTCGCCCCGCGAGCACAG 3’

  15. Nuclear staining ? Cytoskeleton staining? Detection oligos connected to fluorophore, aresensitive to light. From this point, your HAVE to protect your samples from sunlight. Make own boxescovered with foil, or keep them in drawers

  16. Cytoskeleton staining There is one deadly fungi, calledAmanita phalloidesthat produce a toxin that can bind a hinder function of cellular skeletonAGAIN – ACTIN ! One can use a toxin connected to a fluorophore that willemit fluorescence and can be visualized under themicroscope (as in the picture above)

  17. Nuclear staining dsDNA has a big groove (major) and small (minor) Hoeshst is a chemical compound that fits into a minor groove in a DNA = so it does notstain anything else but dsDNA in cell nucleus

  18. Detection oligo hybridization Incubate the reaction mix at RT for 20 minutes (no tapes required) Detection oligos and phalloidin (connected to fluorophore) and hoesht are sensitive to light. From this point, your HAVE to protect your samples from sunlight. Make own boxescovered with foil, or keep them in drawers

  19. In a free time, prepare ETOH 85% in a 50mltube

More Related
SlideServe
Audio
Live Player
Audio Wave
Play slide audio to activate visualizer