1 / 1

Long terminal repeats of porcine endogenous retroviruses in Sus scrofa

Table 2. Clone information of PERV LTR elements in Korean pigs. (A). U3. R U5. Table 1. PCR primers used for amplification of PERV LTR element in Korean pigs. PERV-A (Repbase). S1. S5. S1. S5. S1.

veata
Télécharger la présentation

Long terminal repeats of porcine endogenous retroviruses in Sus scrofa

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Table 2. Clone information of PERV LTR elements in Korean pigs (A) U3 R U5 Table 1. PCR primers used for amplification of PERV LTR element in Korean pigs PERV-A (Repbase) S1 S5 S1 S5 S1 1 73 74 109 110 246 343 373 402 484 (B) PERV-B (Repbase) S1 S5 S1 S5 S1 Clone Acession no. (LTR size) LTR Types Sources 1 73 74 109 110 246 343 373 402 481 PERV-A5 : GAGCCCTAACTCCAGCTTCCTAAA S1 S5 S1 1 52 53 139 140 175 176 312 370 406 429 508 Group1 : CTCTGTATGAACTAGGTGAAAGGACGTAAAATAGGCCCTTGAATGCGTG PERV-A6 S7 S5 S2 S5 S2 S5 S2 S5 S2 S5 S2 Primer Sequences (5'-3') PCR product size (bp) Location Acession no. : TGAGATAACAGGGAAAAGGGTT 1 52 77 162 163 198 199 335 550 580 609 688 PERV-A5-GenBamk CT737311 (589 bp) A5 Sus scrofa : TATTTTAAAATGATTGGT (Original 18bp repeat) S1 PERV-A7 (KYP, KDP, KWP) S7 S6 S1 S5 S2 PERV-A5-KYP AB275589 (628 bp) A5 Hybrid (KDPⅹYorkshire) 1 52 77 163 214 249 250 385 473 503 532 612 PERV-A5-KDP AB275590 (628 bp) A5 Korean domestic pig PERV-A8 (KYP, KDP, KWP) S7 S5 S2 : TGTAGGAAAAATGATTGGT (Subtype of 18bp repeat) S7 1 52 77 162 163 198 199 335 395 425 454 533 PERV-A5-KWP AB275591 (628 bp) Gel purification A5 Korean wild pig Electrophoresis Ligation PERV-A5-S 5'-AAGCCAATCTCCCTTCTTCC-3' 748 125513-125494 CT737311 : TGTTTTAAAACGATTGGT (Subtype of 18bp repeat) Gene Cloning S3 PERV-A6-GenBamk AC138167 (762 bp) A6 Sus scrofa : CCACGGAGCGCGGGCTCTCGA (Original 21bp repeat) : TGTTTTAAAATGATTGGT (Subtype of 18bp repeat) PERV-A5-AS 5'-TATTTCCATCCCTGAACCCA-3' 124785-124766 S5 S2 PERV-A6-KWP1 AB275592 (833 bp) A6 Korean wild pig PCR : CCACGGAGCGCA (Subtype of 21bp repeat) PERV-A6-S 5'-CGTATCCAATCACCTGCATC-3' 899 117570-117589 AC138167 S6 PERV-A6-KWP2 AB275593 (794 bp) A6 Korean wild pig : AGTTTTGAATTGACTGGTTTGTGA (24bp, C type) PERV-A6-AS 5'-CCCCAAATCACTCACGAGAA-3' 118450-118469 S8 PERV-A7-GenBamk CT797462 (694 bp) A7 Sus scrofa : TTGTAAAAGCGCGGGCTTG (19bp, C type) : ATAAAA (TATA signal) PERV-A7-S 5'-CTCAGTGGGTTGGGGTTCT-3' 904 17981-18000 CT797462 S9 : cap site PERV-A7-KYP : TTAAAATTAATTGGT (Subtype of 18bp repeat) AB275594 (694 bp) A7 Hybrid (KDPⅹYorkshire) PERV-A5 PERV-A7-AS 5'-TGCTTTCACAAGTATTCATCCA-3' 17097-17116 S4 S1 S5 S1 S5 S1 (KYP, KDP, KWP) PERV-A7-KDP AB275595 (694 bp) A7 Korean domestic pig 1 52 53 139 140 175 176 312 409 439 468 547 PERV-A8-S 5'-GGAGGGTAGGACACAGTGGA-3' 961 25321-25340 CT827949 PERV-X9 (KYP, KDP, KWP) Group1a S4 S5 S8 S1 S9 PERV-A7-KWP AB275596 (694 bp) A7 Korean wild pig Group2 PERV-A6 (KWP1) PERV-A8-AS 5'-CTTGCATACTTGGGCTTGTG-3' 24380-24399 1 52 53 90 91 131 132 215 218 253 254 402 481 501 512 541 620 S7 S5 S2 S5 S2 S5 S2 S5 S2 S5 S2 S5 S2 S5 S2 PERV-A8-GenBamk CT827949 (609 bp) A8 Sus scrofa 1 52 77 162 163 198 199 335 628 658 687 766 PERV-X10 PERV-X9-S 5'-AGGAGTGGGTTCCAGGTTTC-3' 930 31434-31453 CT955978 S4 S5 S8 S1 S9 PERV-A6 (KWP2) S7 S5 S3 S5 S3 S5 S3 S5 S3 S5 S3 S5 S3 S5 S2 S5 S2 1 52 53 90 91 131 132 215 239 274 275 423 502 522 533 562 641 PERV-A8-KYP AB275597 (609 bp) A8 Hybrid (KDPⅹYorkshire) PERV-X9-AS 5'-AGCAGGTTTAGGTTCACAGCA-3' 30524-30544 Plasmid DNA Isolation 1 52 77 162 163 198 199 335 667 697 726 805 Inoculation Transformation1 PERV-A8-KDP AB275598 (609 bp) A8 Korean domestic pig Transformation2 Deleted region: GCCAGTAA PERV-X10-S 5'-CCTGAAAACTGCACTCTCCTCT-3' 1369 3331-3352 CT009542 Tandem repeated region PERV-A8-KWP AB275599 (609 bp) A8 Korean wild pig PERV-X10-AS 5'-CATTTCTACTGAGCCACAACAG-3' 4677-4698 339 468 Mouse LTR-IS (Repbase) PERV-X9-GenBamk CT955978 (701 bp) X9 Sus scrofa PERV-X9-KYP AB275600 (701 bp) X9 Hybrid (KDPⅹYorkshire) Conserved region PERV-X10-GenBamk CT009542 (722 bp) X10 Sus scrofa Introduction Results & Discussion Abstract References Materials & Methods Genomic DNAs & cDNA PCR & RT-PCR Bioinformatics Long terminal repeats of porcine endogenous retroviruses in Sus scrofa Yun-Ji Kim1Jae-Won Huh1, Byung-Wook Cho2, Dae-Soo Kim3, Hong-Seok Ha1, Ja-Rang Lee1, Kung Ahn1, and Heui-Soo Kim1,3 1 Division of Biological Sciences, College of Natural Sciences, Pusan National University, Busan 609-735, Republic of Korea 2 Department of Animal Science, College of Life Sciences, Pusan National University,Miryang 627-706, Republic of Korea 3 PBBRC, Interdisciplinary Research Program of Bioinformatics, College of Natural Sciences, Pusan National University, Busan 609-735, Republic of Korea http://www..primate.or.kr Using PCR, sequencing, and bioinformatic approaches with the genomic DNAs of Korean pigs (domestic, wild, and hybrid with Yorkshire), twelve solitary PERV long terminal repeat elements were identified and analyzed. Structure analysis of the LTR elements indicated that they have different repeat sequences in the U3 region. The PERV-A6-KWP1 and –KWP2 elements bear seven and eight 39 bp repeats, respectively. The R region of the PERV LTR elements was highly conserved in pig and mouse genomes, suggesting that they seem to have originated from a common exogenous viral element, and then independently evolved throughout the course of mammalian evolution. KWP,KDP,KDP×KYP QIAEX II gel extraction kit(Qiagen) High Pure plasmid isolation kit BLAST,MEGA2 Fig. 1. Schematic representation of various PERV LTR elements (A) and consensus sequences of figured boxes (B). Open boxes indicate the conserved regions, and figured boxes indicate the specific sequences. Closed boxes indicate the different consensus sequences. Different boxes in tandem repeated region indicate the repeat number of tandem repeat sequences. Numbers indicate the specific position in individual LTR sequences. The underlined nucleotide sequences indicate the binding site for the transcription factor, NF-Y. The structures of solitary PERV LTR elements (PERV-A5, -A6, -A7, -A8, -X9, -X10) are derived from Korean pigs, KYP-hybrid of Korean domestic pig × Yorkshire, KDP-Korean domestic pig, and KWP-Korean wild pig (see also Table 2). KWP1 and KWP2 indicate the allele difference in the same individual. Group 2 is PERV-C LTR element and Group 1a is defined by the different copy number of tandem repeated sequences in our sequencing analysis. In the case of the mouse LTR-IS element, only the conserved region (open gray box) has high homology with PERV LTR elements...……………………………………………………………………. • Denner J, Specke V, Thiesen U, Karlas A, Kurth R (2003) Genetic alteration of the long terminal repeat of an ecotropic porcine endogenous retrovirus during passage in human cells. Virology 314: 125-133. • 2. Akiyoshi DE, Denaro M, Zhu S, Greenstein JL, Banerjee P, Fishman JA (1998) Identification of a full-length cDNA for an endogenous retrovirus of miniature swine. J Virol 72: 4503-4507. Genome Information Lab

More Related