Bacterial SSRs
Bacterial SSRs. C hris B ayliss Lecturer in Bacterial Genetics Department of Genetics. Key Messages. Genetic mechanisms can focus mutations to specific regions of genomes (contingency loci) and permit adaptation to specific environmental changes
Bacterial SSRs
E N D
Presentation Transcript
Bacterial SSRs Chris BaylissLecturer in Bacterial GeneticsDepartment of Genetics
Key Messages Genetic mechanisms can focus mutations to specific regions of genomes (contingency loci) and permit adaptation to specific environmental changes Mutation rates in contingency loci are stochastic (contingent responses), high (localised hypermutation) and reversible (phase variation) Fragment analysis can be used to determine the types of mutations and to detect mutations in multiple loci
Do eukaryotes localise mutations to specific regions of the genome?
How can the Rate of Generation of Genetic Variation be Increased? Mutator (genome-wide increase in mutation rate) ii) Localised Hypermutation (localised increase in mutation or recombination rate) iii) Lateral Gene Transfer (recombination with externally-derived DNA molecule)
SELECTION Genome Bacteria X Genome Bacteria X Genome Bacteria X Genome Bacteria X Beneficial mutations Deleterious mutations Mutator
Localised Hypermutation Genome Bacteria Y Genome Bacteria Y Genome Bacteria Y Genome Bacteria Y SELECTION Genome Bacteria X Genome Bacteria X Genome Bacteria X Genome Bacteria X Beneficial mutations Deleterious mutations Mutator
Evolution of Localised Hypermutation Due To Selection Repetitively Acting on Specific Phenotypes Bacteriophage Antibody
Evolution of Localised Hypermutation • Mutation rates vary as a function of DNA sequence - evolution can therefore select for localised increases in mutation rate • Altered phenotype is in close linkage with mutable sequence • Strong selection can maintain unstable DNA sequences
Contingency lociHigh rates of stochastic changes(i.e. localised hypermutation)Non-essential for growth House-Keeping GenesEssential for growthConstitutive expressionLow mutations rates
Population-Based Survival Mechanism No survivors Environment B (e.g. antibodies to protein X) Environment A Environment A Protein X Variant Protein X (or no Protein X)
Critical Features of Localised Hypermutation • Variants generated prior to selection – contingent response • High mutation rates result in small populations containing variants - important for persistence and transmission of commensals/pathogens • No loss of information • No increase in mutations in house-keeping genes
What are the Bacterial Mechanisms of Localised Hypermutation? • Homologous recombination • Intragenomic Recombination/Gene Conversion • Inversions of DNA segments • Methylation of promoter elements • Simple sequence repeats (microsatellites)
A) Antigenic variation AlleleA2 Silent AlleleA1 Constitutive AlleleA3 Constitutive AlleleA2 Silent B) Phase variation - antigenic switch AlleleA1 ‘off’ AlleleA2 ‘on’ AlleleA1 ‘on’ AlleleA2 ‘off’ C) Phase variation - ‘on/off’ switch AlleleA1 ‘on’ AlleleA1 ‘off’
Mutations in Simple Sequence Repeats Cause Phase Variation SELECTION /MUTATION SELECTION /MUTATION MUTATION OFF ON ON Environment B Environment A Environment A G9 G10 G10 HpuA G9 G10 G10 FetA Mutation Frequency = 10-2 to 10-5
What are the Bacterial Mechanisms of Localised Hypermutation? • Homologous recombination • Intragenomic Recombination/Gene Conversion • Inversions of DNA segments • Methylation of promoter elements • Simple sequence repeats (microsatellites)
Simple sequence repeats Multiple copies of the same DNA sequence (note difference with Variable Number Tandem Repeats where repeats are non-identical) Gene or promoter contains a tandem DNA repeat tracts Usually produces an ON/OFF switch in gene expression (phase variation) Can produces subtle changes in gene expression or alter gene length Dependent on DNA replication
Streisinger Model Insertion
Streisinger Model Deletion
In-Frame Repeats ATG………..CAAT(30)…..//………….TAG ON ATG………..CAAT(29)…..TAG OFF ATG………..CAAT(28)……..TAG OFF ATG………..CAAT(27)…..//………….TAG ON Promoter-Located Repeats -35 -10 ATTATA……..TA(10)…….ATTAAA…//…ATG ON ATTATA……..TA(9)…..ATTAAA…//…ATG OFF
Phase variable addition of phosphorylcholine (ChoP) to the lipopolysaccharide (LPS) of H. influenzae Lic1 D A B C Non-typeable H. influenzae strain probed with antibody TEPEC-15 (Weiser et al., 1997) ATGAATACAAAAATGCTATG (CAAT) CAAATTGTA 30
Repeat-mediated Translational Phase Variation of lic1 in H. influenzae 31 5’CAAT = ON, full-length protein ATG AAT ACA AAA ATG CTA TGC AAT(CAAT)30 CAA ATT GTA AAT GAT - 885nt - TAA M N T K M L C N (QSIN)9 Q I V N E - 295aa - * + 1 repeat = OFF, truncated protein ATG AAT ACA AAA ATG CTA TGC AAT(CAAT)30CAA TCA AAT TGT AAA TGA T - 885nt - TAA M N T K M L C N (QSIN)8 Q S N C K * + 2 repeats = OFF, truncated protein ATG AAT ACA AAA ATG CTA TGC AAT(CAAT)30CAA TCA ATC AAA TTG TAA ATG AT - 885nt - TAA M N T K M L C N (QSIN)8 Q S I K L *
Repeat-mediated Translational Phase Variation of lic1 in H. influenzae 31 5’CAAT = ON, full-length protein ATG AAT ACA AAA ATG CTA TGC AAT(CAAT)30 CAA ATT GTA AAT GAT - 885nt - TAA M N T K M L C N (QSIN)9 Q I V N E - 295aa - * + 2 repeats = OFF, truncated protein = ATG1 + 2 repeats = ON, full-length protein = ATG3 3 2 1 ATG AAT ACA AAA ATG CT ATG (CAAT)30CAA TCA ATC AAT CAA ATT GTA AAT GAT - 885nt - TAA M (QSIN)8 Q S I N Q I V N E - 295aa - *
Repeat-Mediated Transcriptional Phase Variation of FetA in N. gonorrhoeae fetA -35 -10 +1 CAGCTTTACACAACCCCCCCCCCCGCTAATATAAACA Carson et al. 2000 Mol. Micro. 36: 585
FetA Expression High Expression CAGCTTTACACAACCCCCCCCCCCGCTAATATAAACA -35 -10 12 C (17 nt) Low Expression CAGCTTTACACAACCCCCCCCCCGCTAATATAAACA -35 -10 11 C (16 nt)
Regulation of Hypermutation • Mutation rates can be regulated by cis-acting or trans-acting factors • Alterations in cis- or trans-acting factors can alter the mutation rate • Mutability can evolve in response to selection pressures • Mutability can be regulated by the environment • Mutability can be subject to cross-regulation by other mutable systems
Reporter gene constructs used to measure mutation rates of a Haemophilus influenzae simple sequence contingency locus Number of repeats 40 AGTC 17-38 AGTC 0 10-20 AT
Influence of tetranucleotide repeat tract length on phase variation rates in H. influenzae 5 ON-to-OFF 4 3 2 OFF-to-ON 1 0 15 20 25 30 35 40 Number of repeats
Numbers of repeats in the SSCL of non-typeable H. influenzae strains lic1A 18-39 CAAT (25 strains) lic2A 7-31 CAAT (23 strains) lic3A 14-41 CAAT (24 strains) lgtC 13-43 GACA (22 strains) lex2 3-41 GCAA (23 strains) mod 0-23 AGCC (23 strains)
Mismatch Repair as a Trans-Acting Factor Bacterial mismatch repair systems correct mismatches and frameshifts of 1-3 nucleotides Phase variation rates of Haemophilus influenzae or Neisseria meningitidis genes containing tetranucleotide repeats genes are NOT controlled by inactivation of mismatch repair Phase variation rates of Neisseria meningitidis genes containing mononucleotide repeats are controlled by inactivation of mismatch repair Natural isolates of Neisseria meningitidis have high phase variation rates due to mutations in mismatch repair genes
Functional Groups • Evasins • Adhesins • Iron acquisition proteins • LPS biosynthetic enzymes • Restriction-modification systems • Flagella • Other surface proteins (lipoproteins) • Metabolism-associated functions • Other functions (regulators, phage genes)
Functions of the Products of Contingency Loci Lipoproteins Flagella Biosynthetic Enzymes Iron Acquisition Proteins Capsule Biosynthetic Enzymes LOS/LPS Biosynthetic Enzymes Adhesins Metabolic functions Regulators Restriction Enzyme
Phenotypic Consequences of Phase Variation • Evasion of host immunity • Antigenic variation • Immune evasion • Host mimicry • Evasion of innate immunity • Classic • Acquisition of nutrients • Evasion of bacteriophages • Role in transmission • Other
Mutations in Simple Sequence Repeats Cause Phase Variation SELECTION /MUTATION SELECTION /MUTATION MUTATION OFF ON ON Environment A Environment A: High Levels of Haptoglobin:Haemoglobin Environment B: Immune response?? Other? HpuA
Number of Genotypes Antigenic Variation Gene Conversion = large (infinite) number Phase Variation Phase variable locus (any mechanism) = 2 genotypes (ON and OFF) Phase variable locus (repetitive DNA) = 3+ genotypes (high, intermediate, low) Phase variable locus (complex site specific) = multiple genotypes
Bacteria with Loci Subject to Repeat-Mediated Localised Hypermutation Multiple Loci • Haemophilus influenzae 12 • Neisseria meningitidis 40 • Neisseria gonorrhoeae 50 • Helicobacter pylori 27 • Campylobacter jejuni 27
Reporter Constructs for Detecting Phase Variation in Campylobacter jejuni cj1139c cat lacZ G8 G8 lacZ G11 capA (cj0628/cj0629) T6-G11 Strain NCTC11168 ON CapA a-CapA antibodies (surface-located autotransporter)
On-to-off ‘off’ variant Off-to-on ‘on’ variant
MHA-VT plates MHA-VT-XGal plates
Analysis of the Mutational Type in a Phase Variant of C. jejuni reporter construct cat cj1139 lacZ G11 G11-OFF Variant G11-ON Variant