verda
Uploaded by
62 SLIDES
798 VUES
620LIKES

Bacterial SSRs

DESCRIPTION

Bacterial SSRs. C hris B ayliss Lecturer in Bacterial Genetics Department of Genetics. Key Messages. Genetic mechanisms can focus mutations to specific regions of genomes (contingency loci) and permit adaptation to specific environmental changes

1 / 62

Télécharger la présentation

Bacterial SSRs

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

Playing audio...

  1. Bacterial SSRs Chris BaylissLecturer in Bacterial GeneticsDepartment of Genetics

  2. Key Messages Genetic mechanisms can focus mutations to specific regions of genomes (contingency loci) and permit adaptation to specific environmental changes Mutation rates in contingency loci are stochastic (contingent responses), high (localised hypermutation) and reversible (phase variation) Fragment analysis can be used to determine the types of mutations and to detect mutations in multiple loci

  3. Do eukaryotes localise mutations to specific regions of the genome?

  4. How can the Rate of Generation of Genetic Variation be Increased? Mutator (genome-wide increase in mutation rate) ii) Localised Hypermutation (localised increase in mutation or recombination rate) iii) Lateral Gene Transfer (recombination with externally-derived DNA molecule)

  5. SELECTION Genome Bacteria X Genome Bacteria X Genome Bacteria X Genome Bacteria X Beneficial mutations Deleterious mutations Mutator

  6. Localised Hypermutation Genome Bacteria Y Genome Bacteria Y Genome Bacteria Y Genome Bacteria Y SELECTION Genome Bacteria X Genome Bacteria X Genome Bacteria X Genome Bacteria X Beneficial mutations Deleterious mutations Mutator

  7. Evolution of Localised Hypermutation Due To Selection Repetitively Acting on Specific Phenotypes Bacteriophage Antibody

  8. Evolution of Localised Hypermutation • Mutation rates vary as a function of DNA sequence - evolution can therefore select for localised increases in mutation rate • Altered phenotype is in close linkage with mutable sequence • Strong selection can maintain unstable DNA sequences

  9. Contingency lociHigh rates of stochastic changes(i.e. localised hypermutation)Non-essential for growth House-Keeping GenesEssential for growthConstitutive expressionLow mutations rates

  10. Population-Based Survival Mechanism No survivors Environment B (e.g. antibodies to protein X) Environment A Environment A Protein X Variant Protein X (or no Protein X)

  11. Critical Features of Localised Hypermutation • Variants generated prior to selection – contingent response • High mutation rates result in small populations containing variants - important for persistence and transmission of commensals/pathogens • No loss of information • No increase in mutations in house-keeping genes

  12. What are the Bacterial Mechanisms of Localised Hypermutation? • Homologous recombination • Intragenomic Recombination/Gene Conversion • Inversions of DNA segments • Methylation of promoter elements • Simple sequence repeats (microsatellites)

  13. A) Antigenic variation AlleleA2 Silent AlleleA1 Constitutive AlleleA3 Constitutive AlleleA2 Silent B) Phase variation - antigenic switch AlleleA1 ‘off’ AlleleA2 ‘on’ AlleleA1 ‘on’ AlleleA2 ‘off’ C) Phase variation - ‘on/off’ switch AlleleA1 ‘on’ AlleleA1 ‘off’

  14. Mutations in Simple Sequence Repeats Cause Phase Variation SELECTION /MUTATION SELECTION /MUTATION MUTATION OFF ON ON Environment B Environment A Environment A G9 G10 G10 HpuA G9 G10 G10 FetA Mutation Frequency = 10-2 to 10-5

  15. What are the Bacterial Mechanisms of Localised Hypermutation? • Homologous recombination • Intragenomic Recombination/Gene Conversion • Inversions of DNA segments • Methylation of promoter elements • Simple sequence repeats (microsatellites)

  16. Simple sequence repeats Multiple copies of the same DNA sequence (note difference with Variable Number Tandem Repeats where repeats are non-identical) Gene or promoter contains a tandem DNA repeat tracts Usually produces an ON/OFF switch in gene expression (phase variation) Can produces subtle changes in gene expression or alter gene length Dependent on DNA replication

  17. Streisinger Model

  18. Streisinger Model

  19. Streisinger Model Insertion

  20. Streisinger Model

  21. Streisinger Model Deletion

  22. Long Tracts of Simple Sequence Repeats in Bacterial Genomes

  23. In-Frame Repeats ATG………..CAAT(30)…..//………….TAG ON ATG………..CAAT(29)…..TAG OFF ATG………..CAAT(28)……..TAG OFF ATG………..CAAT(27)…..//………….TAG ON Promoter-Located Repeats -35 -10 ATTATA……..TA(10)…….ATTAAA…//…ATG ON ATTATA……..TA(9)…..ATTAAA…//…ATG OFF

  24. Phase variable addition of phosphorylcholine (ChoP) to the lipopolysaccharide (LPS) of H. influenzae Lic1 D A B C Non-typeable H. influenzae strain probed with antibody TEPEC-15 (Weiser et al., 1997) ATGAATACAAAAATGCTATG (CAAT) CAAATTGTA 30

  25. Repeat-mediated Translational Phase Variation of lic1 in H. influenzae 31 5’CAAT = ON, full-length protein ATG AAT ACA AAA ATG CTA TGC AAT(CAAT)30 CAA ATT GTA AAT GAT - 885nt - TAA M N T K M L C N (QSIN)9 Q I V N E - 295aa - * + 1 repeat = OFF, truncated protein ATG AAT ACA AAA ATG CTA TGC AAT(CAAT)30CAA TCA AAT TGT AAA TGA T - 885nt - TAA M N T K M L C N (QSIN)8 Q S N C K * + 2 repeats = OFF, truncated protein ATG AAT ACA AAA ATG CTA TGC AAT(CAAT)30CAA TCA ATC AAA TTG TAA ATG AT - 885nt - TAA M N T K M L C N (QSIN)8 Q S I K L *

  26. Repeat-mediated Translational Phase Variation of lic1 in H. influenzae 31 5’CAAT = ON, full-length protein ATG AAT ACA AAA ATG CTA TGC AAT(CAAT)30 CAA ATT GTA AAT GAT - 885nt - TAA M N T K M L C N (QSIN)9 Q I V N E - 295aa - * + 2 repeats = OFF, truncated protein = ATG1 + 2 repeats = ON, full-length protein = ATG3 3 2 1 ATG AAT ACA AAA ATG CT ATG (CAAT)30CAA TCA ATC AAT CAA ATT GTA AAT GAT - 885nt - TAA M (QSIN)8 Q S I N Q I V N E - 295aa - *

  27. Repeat-Mediated Transcriptional Phase Variation of FetA in N. gonorrhoeae fetA -35 -10 +1 CAGCTTTACACAACCCCCCCCCCCGCTAATATAAACA Carson et al. 2000 Mol. Micro. 36: 585

  28. FetA Expression High Expression CAGCTTTACACAACCCCCCCCCCCGCTAATATAAACA -35 -10 12 C (17 nt) Low Expression CAGCTTTACACAACCCCCCCCCCGCTAATATAAACA -35 -10 11 C (16 nt)

  29. Control of the Mutation Rates of Contingency Loci

  30. Regulation of Hypermutation • Mutation rates can be regulated by cis-acting or trans-acting factors • Alterations in cis- or trans-acting factors can alter the mutation rate • Mutability can evolve in response to selection pressures • Mutability can be regulated by the environment • Mutability can be subject to cross-regulation by other mutable systems

  31. Reporter gene constructs used to measure mutation rates of a Haemophilus influenzae simple sequence contingency locus Number of repeats 40 AGTC 17-38 AGTC 0 10-20 AT

  32. Influence of tetranucleotide repeat tract length on phase variation rates in H. influenzae 5 ON-to-OFF 4 3 2 OFF-to-ON 1 0 15 20 25 30 35 40 Number of repeats

  33. Numbers of repeats in the SSCL of non-typeable H. influenzae strains lic1A 18-39 CAAT (25 strains) lic2A 7-31 CAAT (23 strains) lic3A 14-41 CAAT (24 strains) lgtC 13-43 GACA (22 strains) lex2 3-41 GCAA (23 strains) mod 0-23 AGCC (23 strains)

  34. Mismatch Repair as a Trans-Acting Factor Bacterial mismatch repair systems correct mismatches and frameshifts of 1-3 nucleotides Phase variation rates of Haemophilus influenzae or Neisseria meningitidis genes containing tetranucleotide repeats genes are NOT controlled by inactivation of mismatch repair Phase variation rates of Neisseria meningitidis genes containing mononucleotide repeats are controlled by inactivation of mismatch repair Natural isolates of Neisseria meningitidis have high phase variation rates due to mutations in mismatch repair genes

  35. Functions of Contingency Loci

  36. Functional Groups • Evasins • Adhesins • Iron acquisition proteins • LPS biosynthetic enzymes • Restriction-modification systems • Flagella • Other surface proteins (lipoproteins) • Metabolism-associated functions • Other functions (regulators, phage genes)

  37. Functions of the Products of Contingency Loci Lipoproteins Flagella Biosynthetic Enzymes Iron Acquisition Proteins Capsule Biosynthetic Enzymes LOS/LPS Biosynthetic Enzymes Adhesins Metabolic functions Regulators Restriction Enzyme

  38. Phenotypic Consequences of Phase Variation • Evasion of host immunity • Antigenic variation • Immune evasion • Host mimicry • Evasion of innate immunity • Classic • Acquisition of nutrients • Evasion of bacteriophages • Role in transmission • Other

  39. Mutations in Simple Sequence Repeats Cause Phase Variation SELECTION /MUTATION SELECTION /MUTATION MUTATION OFF ON ON Environment A Environment A: High Levels of Haptoglobin:Haemoglobin Environment B: Immune response?? Other? HpuA

  40. Impact of Localised Hypermutation on Phenotypic Diversity

  41. Number of Genotypes Antigenic Variation Gene Conversion = large (infinite) number Phase Variation Phase variable locus (any mechanism) = 2 genotypes (ON and OFF) Phase variable locus (repetitive DNA) = 3+ genotypes (high, intermediate, low) Phase variable locus (complex site specific) = multiple genotypes

  42. Bacteria with Loci Subject to Repeat-Mediated Localised Hypermutation Multiple Loci • Haemophilus influenzae 12 • Neisseria meningitidis 40 • Neisseria gonorrhoeae 50 • Helicobacter pylori 27 • Campylobacter jejuni 27

  43. Campylobacter jejuni:- Phase Variation Frequencies

  44. Reporter Constructs for Detecting Phase Variation in Campylobacter jejuni cj1139c cat lacZ G8 G8 lacZ G11 capA (cj0628/cj0629) T6-G11 Strain NCTC11168 ON CapA a-CapA antibodies (surface-located autotransporter)

  45. On-to-off ‘off’ variant Off-to-on ‘on’ variant

  46. MHA-VT plates MHA-VT-XGal plates

  47. Analysis of the Mutational Type in a Phase Variant of C. jejuni reporter construct cat cj1139 lacZ G11 G11-OFF Variant G11-ON Variant

More Related