Achim Tresch Computational Biology
710 likes | 927 Vues
‘Omics’ - Analysis of high dimensional Data. Achim Tresch Computational Biology. Epigenetics. Slides: Doug Brutlag , Stanford University School of Medicine http://biochem158.stanford.edu/Epigenetics.html. Epigenetics.
Achim Tresch Computational Biology
E N D
Presentation Transcript
‘Omics’ - Analysis of high dimensional Data Achim TreschComputational Biology
Epigenetics Slides: Doug Brutlag, Stanford University School of Medicine http://biochem158.stanford.edu/Epigenetics.html
Epigenetics • C.H. Waddington coined the term epigenetics to mean above or in addition to genetics to explain differentiation. • How do different adult stem cells know their fate? • Myoblasts can only form muscle cells • Keratinocytes only form skin cells • Hematopoetic cells only become blood cells • But all have identical DNA sequences.
Epigenetics • Modern definition is non-sequence dependent inheritance. • How can identical twins have different natural hair colors? • How can a single individual have two different eye colors?
Mosaicism: One Eye, two Colors • How can identical twin liter mates show different coat colors? • How can just paternal or maternal traits be expressed in offspring? This is called genetic imprinting. • How can females express only one X chromosome per cell? • How can acquired traits be passed on to offspring?
The ‘epigenetic’ code DNA Methylation & Histone Modifications Paula Vertino, Henry Stewart Talks
Methylation of Cytosine in DNA cytosine 5-methyl cytosine Paula Vertino, Henry Stewart Talks
Methylation of Cytosine in DNA Paula Vertino, Henry Stewart Talks
DNA Methylation (Biochemistry) • CpG dinucleotides are partially methylated in higher vertebrates • Human genome: only ~4% of all cytosines are methylated, but ~ 70%-80% 5mCpG • Spontaneous deamination transforms CpG to TpG or CpA • Estimated rate (after DNA-repair)[1]: 5.8*10-13 (5.8*10-17) 1/s*sites 5-methylcytosine - thymine cytosine - uracil [1] Shen et al. (1993) Nucl. Acids Res. Wikipedia: Deamination, Thymine, 5-methylcytosine
Maintenance of Cytosine Methylation Alex Meissner, Henry Stewart Talks
DNA Methylation and Cell Differentiation Alex Meissner, Henry Stewart Talks
DNA Methylation and Cell Differentiation Alex Meissner, Henry Stewart Talks
DNA Methylation and Cell Differentiation Nuclear transplantation: Differentiated Cells can become Totipotent
Methylation Changes During Development Methylation level Paula Vertino, Henry Stewart Talks
Methylation Changes During Development Methylation level Paula Vertino, Henry Stewart Talks
Methylation Changes During Development Methylation level Paula Vertino, Henry Stewart Talks
DNA Methylation and Histone Marks • DNA methylation– bisulfite sequencing • Histone modification • chromatin immunoprecipitation (ChIP) TTCGCCGACTAA TTCGCCGAuTAA
DNA Methylation and Histone Marks Using next-generation sequencing, epigenetic modifications can be identified genome-wide: EPIGENOMICS and METHYLOMICS GREEN = H3K27me3 PURPLE = methylcytosine
DNA methylation and Gene Expression http://www.39kf.com/uploadfiles/image/15902/TXT-20081228163836878.gif
Epigenomics • Methylation in mammals is mainly targeted at CpG dinucleotides • CpGs are either unmethylated or methylated on both strands • Hemi-methylated CpGs are rare • DNA methyltransferases (DNMTs) bind hemi-methylated sites and modify the remaining position • Thus the epigenetic information is inherited to daughter cells • Lars Feuerbach Adapted from: http://www.diagenode.com/en/applications/bisulfite-conversion.php
Bisulfite Sequencing NH2 NH2 NH2 O Methyl-cytosine TTCGCCGACTAA CH3 CH3 N N N N No treatment Bisulfite treatment cytosine 5-methylcytosine N N N N O O O O ~ ~ ~ ~ TTCGCCGAuTAA TTCGCCGACTAA Bisulfite treatment When DNA is bisulfite treated, unmethylated cytosine is converted to uracil. Methylcytosine is not affected. uracil 5-methylcytosine
Bisulfite Sequencing Methyl-cytosine TTCGCCGACTAA After bisulfite treatment, unmethylated Cs are read as T and so differ in the treated and untreated samples. By contrast, methyl-C is read as C and is the same as the reference sequence. No treatment Bisulfite treatment TTCGCCGACTAA TTCGCCGAuTAA TTCGCCGACTAA TTCGCCGATTAA
Reduced Representation Bisulfite Sequencing RRBS-Seq • DNA is digested by MSP1 restriction enzyme which cuts at CCGG sites • All DNA fragments start with CpG • Alignment is simplified as reads have to map to MSP1 restriction sites • Reads are enriched for CpG rich areas TATGC CGGATGTTTTGTACTAGGATAAC CGGAT http://www.neb.com/nebecomm/products/productR0106asp
Alignment of BS converted reads Standard alignment to the reference is not possible. Adapted alignment procedures have lower accuracy. Reference Read out
Alignment of BS converted reads • Key concept: • Convert the reference genome in silico as bilufite treatment does • Perform conversion for + strand and – strand • Then align reads against both genomes Tools supporting the alignment of BS reads: • Bismark • BSMAP • BS Seeker Simon Andrews, Bioinformatics 2011
Alignment of BS converted reads H = IUPAC character for the letters {A,C,T} Simon Andrews, Bioinformatics 2011
Description of DNA methylation Pearl-Necklace diagrams (lollipop plots) • Measure unmethylated Cs (#C) • Measure methylated Cs (#5mC) • Report the methylation ratio
The Tomato Methylome Density of methylated DNA and other features in chromosomes of the tomato fruit Reprinted by permission from Macmillan Publishers Ltd: Zhong, S., Fei, Z., Chen, Y.R., Zheng, Y., Huang, M., Vrebalov, J., McQuinn, R., Gapper, N., Liu, B., Xiang, J., Shao, Y., and Giovannoni, J.J. (2013). Single-base resolution methylomes of tomato fruit development reveal epigenome modifications associated with ripening. Nat Biotechnol. [in press].
Evolution of CpG content in repetitive sequences Peifer et al. (2008) Bioinformatics
Evolution of CpG-rich promoters • AT-rich promoters in bacteria • Mixed promoters in worm and fly • Increasing GC and CpG content in mosquito • Small CpG islands in fish • Broad CpG islands in humans Khuu et al., PNAS, Sep. 2007
Promoter Types in Humans Weber et al., 2007, Nat. Genet.
CpG island definitions • CpG island definition: • GC-content • Ratio observed over expected CpG frequency • Minimal Length
CpG islands • CpG dinucleotides are rare in the human genome • CpG Islands are exceptions • Elevated GC content and CpG frequency • 50-60% of promoters are CpG islands • Methylation level anti-correlated to expression in HCP promoters • Cause or consequence ?
CpG islands and chromatin Caiafa and Zampieri,(2005) JCB
Histone modifications • How to read the nomenclature: • Histone protein (H3) • Position in tail (K9) • Modification type (me3) Füllgrabe et al., 2011, Oncogene
Histone code • Füllgrabe et al., 2011, Oncogene
Ceder&Bergman,2009,Nature Rev Genet Interplay