10 likes | 151 Vues
Take home notes. miR-1 and miR-133a expression were down-regulated in tumor tissues and their expression were positively correlated in normal and tumor tissues. Genome-wide analysis revealed that TAGLN2 and PNP were common target genes of miR-1 and miR-133a.
E N D
Take home notes • miR-1 and miR-133a expression were down-regulated in tumor tissues and their expression were positively correlated in normal and tumor tissues. • Genome-wide analysis revealed that TAGLN2 and PNPwere common target genes of miR-1 and miR-133a. • TAGLN2 and PNPexpression were inversely correlated with miR-1 and miR-133a expression in HNSCC. • Loss-of-function assay indicates that TAGLN2 and PNP may act as oncogenes in HNSCC. • TAGLN2 is a member of the calponinfamily of actin-binding proteins. Overexpression of TAGLN2 was observed in hepatocellular carcinoma, lung adenocarcinoma, pancreatic and bladder cancer. • PNP is an enzyme involved in purine metabolism. PNP catalyzes the conversion of adenosine to adenine, inosine to hypoxanthine, and guanosine to guanine, creating ribose phosphate in each case. PNP is considered a therapeutic target in malignant lymphoproliferative diseases. Chromosome 20q13.33 61.0M 61.1M 61.2M 61.3M Molecular networks regulated by tumor suppressive microRNA-1 and microRNA-133a in head and neck squamous cell carcinoma Abstract #3152 120 TAGLN2 mRNA expression (relative to mock) 120 RPL7P3 LOC100505735 LOC100127888 LOC100131174 FLJ32154 PNP mRNA expression (relative to mock) 100 NijiroNohata1,2, Toyoyuki Hanazawa1, Takashi Kinoshita1,2, Naoko Kikkawa1, Miki Fuse2, Takeshi Chiyomaru3, Hirofumi Yoshino3, Hideki Enokida3, Masayuki Nakagawa3, Yoshitaka Okamoto1 and Naohiko Seki2 C20orf151 GATA5 C20orf166-AS1 100 80 80 C20orf166 SLCO4A1 1Department of Otorhinolaryngology / Head and Neck Surgery, Graduate School of Medicine, Chiba University, Chiba Japan 2Department of Functional Genomics, Graduate School of Medicine, Chiba University, Chiba, Japan 3Department of Urology, Graduate School of Medical and Dental Sciences, Kagoshima University, Kagoshima, Japan 60 60 Exon1 2 3 4 * 61147660 61167971 40 * 40 * 10.5Kb miR-1-1 miR-133a-2 * 20 20 p=0.0089 p=0.0321 Chromosome 18q11.2 0 0 0.4k 0.2k Background and Aims of study 0.2k 0.4k 0.6k 19.2M 19.3M 19.4M 19.5M Expression levels of miR-1 and miR-133a in clinical HNSCC samples miR-320c-1 RPL34P32 p=0.0023 p=0.0382 r=0.571 p<0.001 r=-0.266 p=0.098 r=-0.322 p=0.043 miR-1 and miR-133a expression levels in tumor tissue were significantly down-regulated in clinical HNSCC samples. Furthermore, miR-1 and miR-133a expression levels were positively correlated in HNSCC samples. SNRPD1 ABHD3 MIB1 0.035 0.040 0.125 2 2 0.035 0.030 0.100 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 Exon 1 0.030 PNP mRNA PNP mRNA 0.025 19321545 19450914 1 1 0.075 0.025 miR-1 expression (Normalized to RNU48) miR-133a expression miR-133a expression (Normalized to RNU48) 0.020 miR-133a-1 miR-1-2 0.050 0.020 3.2Kb 0.015 0.015 0 0 0.025 0.010 0 0 0.05 0.10 0.15 0.02 0.04 0.010 0 miR-1 miR-133a 0.005 0.005 0 0.02 0.04 0 0 miR-1 expression Normal Tumor Normal Tumor miR-1 and miR-133a Inhibited cell growth and inducedapoptosis in IMC-3 (derived from maxillary sinus SCC) TAGLN2 and PNP were regulated by miR-1 and miR-133a * 7 Our expression signatures of human cancer including HNSCC revealed that the expression of microRNA-1 (miR-1) and microRNA-133a (miR-133a) were significantly reduced in cancer cells. In human genome, miR-1 and miR-133a located same chromosomal regions (miR-1-2 and miR-133a-1 on 18q11.2, and miR-1-1 and miR-133a-2 on 20q13.33) called cluster. Previously, our group reported that miR-1 and miR-133a function as tumor suppressors in several types of cancers including HNSCC. In this study, we identify the novel molecular networks regulated by miR-1 and miR-133a commonly in HNSCC. 120 6 *:p<0.05 TAGLN2 3’UTR length:686 5 100 TAGLN2 miR-1 target sites * β-actin Early apoptosis cells (relative to mock) 4 80 Cell proliferation (% of mock) * 120 60 3 5' ...UAUAUUUUAGCAGUGACAUUCCC... ||||||| 3' UAUGUAUGAAGAAAUGUAAGGU 5' ...CCCAUGCUUACUAAU--ACAUUCCC... |||| ||||||| 3' UAUGUAUGAAGAAAUGUAAGGU 5' ...UCUGUGUCCUCCGUUCAUUCCAU... |||||| 3' UAUGUAUGAAGAAAUGUAAGGU 100 * 40 2 80 TAGLN2 normalized to β-actin miR-133a target sites 60 20 40 1 20 0 0 0 Down-regulated genes by miR-1 and miR-133a in IMC-3 5' ...AUAGCCAUCAAAACUGGACCAAC... ||||||| 3' GUCGACCAACUUCCCCUGGUUU 5' ...UCUUCCUUUCCCCUGGGACCAAA... ||||||| 3' GUCGACCAACUUCCCCUGGUUU Mock Control miR-1 miR-133a *:p<0.05 *:p<0.05 Overexpression of TAGLN2and PNPin clinical HNSCC samples PNP 4 4 4.0 r=-0.407 p=0.009 r=-0.341 p=0.031 β-actin PNP 3’UTR length:488 3.0 miR-1 target sites TAGLN2 expression (Normalized to GUSB) 120 TAGLN2 mRNA TAGLN2 mRNA 2 2 2.0 100 80 PNP normalized to β-actin 1.0 si-TAGLN2 and si-PNPinhibited cell growth in IMC-3 60 5' ...GCUCUUUGAGAUAAUACAUUCCG... ||||||| 3' UAUGUAUGAAGAAAUGUAAGGU 40 0 0 20 0 miR-133a target sites Normal Tumor 0 0 0 0.02 0.04 0.05 0.10 0.15 miR-1 miR-133a 5' ...AUCUAAAUCACCAGAGACCAAAC... |||||| 3' GUCGACCAACUUCCCCUGGUUU Inverse correlation between TAGLN2 andmiR-1/miR-133a 2.0 Mock Control miR-1 miR-133a 120 Cell proliferation (% of mock) Cell proliferation (% of mock) 120 PNP expression (Normalized to GUSB) 100 100 * 1.0 80 80 *:p<0.05 *:p<0.05 * 60 60 0 Mock Mock Normal Tumor 40 40 Control Control 20 20 si-TAGLN2 si-PNP 0 0 Inverse correlation between PNP andmiR-1/miR-133a AACR 103rdANNUAL MEETING, Tuesday April 3, 2012, 8:00 AM – 12:00 PM