zola
Uploaded by
21 SLIDES
1450 VUES
340LIKES

Gene knockout

DESCRIPTION

Gene knockout. Lecturer : Du Shengyang January 24 2013. Minimum genome Based on a kind of ideal hypothesis It a ssume that cells contain a minimal gene set Under the condition of the gene set to maintain normal life functions reduced genome

1 / 21

Télécharger la présentation

Gene knockout

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Gene knockout Lecturer:Du Shengyang January 242013

  2. Minimum genome Based on a kind of ideal hypothesis It assume that cells contain a minimal gene set Under the condition of the gene set to maintain normal life functions reduced genome Gradually eliminate nonessential gene sequence

  3. The significance of gene knockout Gene knockout can reduce the redundancy of biological system Identify specific essential genes Improve metabolic efficiency Controllability and predictability higher

  4. nonessential genes and sequences recombinogenicor mobile DNA and cryptic virulence genes gene cluster related to different secondary metabolites synthesis IS sequence Redundancy sequence

  5. The common method 1、homologous recombination 2、Insertion mutation 3、RNAi

  6. Red recombination 1.red and Sce I cutting 2.Two step to Redrecombination

  7. Target gene LoxP Cre Cre-LoxPSystem LoxP : ATAACTTCGTATAGCATACATTATACGAAGTTAT ATAACTTCGTATA TATTGAAGCATAT

  8. a novel Bacillus subtilisstrain,MBG874,depleted of 874 kb (20%) of the genomic sequence productivity of extracellular cellulase and protease from transformed plasmids harboring the corresponding genes is remarkably enhanced

  9. a new genetic strategy based on the Cre-loxPrecombination system to generate large chromosomal rearrangements in Lactococcuslactis. The Cre-loxPrecombination system described can potentially be used for other gram-positive bacteria without further modification.

  10. Chromosomal inversions in Lactocoaal

  11. All inversions have an effect on the cell fitness compared to that associated with the corresponding isogenic parental structure, with a decrease in growth rate ranging from 8 to 18% depending on the extent of the chromosome disorganization it can potentially be used for generating rearrangements in any region of the bacterial chromosome.

  12. It will be a powerful tool for purposes such as control of the copy number of integrated exogenous DNA in gene expression investigations or shuffling of the bacterial chromosome (by deletions or inversions) for applied and fundamental genome studies.

  13. Our subject Confirm the target that can be deleted In other hand, we can not affect the bacteria growth and nisinsynthetic Using some Gene knockout techniques deletes IS sequence and gene cluster related tosecondary metabolites synthesis.(upp or Cre-loxP ) Experimental verification and analysis

  14. Thank You !

More Related