300 likes | 460 Vues
An Action Sequencing-based View of Dynamic Competitive Interaction. WALTER J. FERRIER University of Kentucky. November 1999. Competitive Outcomes. Competitive Interaction. Firm A’s Actions. Firm B’s Actions. Organizational Characteristics. Industry Characteristics. Action Char.
E N D
An Action Sequencing-based View of Dynamic Competitive Interaction WALTER J. FERRIER University of Kentucky November 1999
Competitive Outcomes Competitive Interaction Firm A’s Actions Firm B’s Actions Organizational Characteristics Industry Characteristics
Action Char. Irreversibility Magnitude Radicality Reaction Char. Likelihood Type Speed Prior Studies: Action-Reaction Dyads Event Dyad 1 Event Dyad 2 Event Dyad 3 Event Dyad 4 Actor 1 Actor 2 time
Firm Performance Profitability Sales growth Market share Repertoire Char. Total actions Simplicity Avg. Timing Prior Studies: Action Repertoires Actor 1 Year-End Measures Actor 2 time
Named Sequences: Epaulette’s Mate Sicilian Defense Sequential Competitive Interaction ? 8 7 6 5 4 3 2 1 • This Sequence: • Black: Knight b4 • White: Pawn c3 • Black: Bishop g4 • White: Queen b5 • Black: Pawn c5 a b c d e f g h
Sequences in Strategy Research? • Ordered sample of things • Temporal orderliness among elements • Logically unified sequence • Succession of market-based decisions • Patterns in stream of behaviors • Coordinated series of actions • Actions in a sequential strategic thrust
Action Sequences Event Sequence 1 Event Sequence 2 time • Sequence Structure • Predictability • Complexity • Timing • Duration • Firm Performance • Profitability • Sales growth • Market share
Competing Forces for Strategic Change and Adaptation Enabling Forces Timing Constraining Forces Action Type(s) Predictability
Factors Influencing Sequence Structure TMT Heterogeneity Slack Complexity Unpredictability Differentiation Response Timing Duration Awareness Motivation Ability Rival’s Actions Industry Growth Barriers to Entry
Sequence Structure and Performance Sequence Structure: Complexity Unpredictability Differentiation Fast Response Timing Long Duration Firm Performance: Sales Growth Profitability
Sample and Data • Matched pairs: • Single-/Dominant-business firms (S.R. > .70) • U.S. market share leaders and challenger (No.2) • 1987-1993 Cross-sectional time series panel • Actions: • News reportsin F&S Predicasts, 1987-93 • Structured content analysis • Reliable set of key words
Action Sequence • Ordered sample of action events Time • Competitive actions: • Externally-directed, specific, observable moves • Smith, Grimm, Gannon & Chen, 1991 • Miller & Chen, 1996 • Hambrick, Cho & Chen, 1996 • Young, Smith & Grimm, 1996 • Ferrier, Smith & Grimm, 1999
Sequence Structure Time • Elemental Complexity • Herfindahl Index of within-sequence action diversity • Low Scores: Complex sequence • High Scores: Simple sequence MKT MKT PRICE PROD SIG MKT PRICE
Inter-sequence Dissimilarity Time Sequence 1 • Unpredictability (focal firm) • Differentiated (vis-à-vis rival firm) • Optimal Matching: Index of resemblance of two sequences, INDEL costs • High scores: Sequences are different • Low scores: Sequences are similar MKT MKT PRICE PROD MKT MKT PRICE MKT PRICE PROD SIG PRICE MKT Sequence 2
Sequence Chronology Time Focal Firm • Average Sequence Duration (a) • Greater No. days: Firm sustains attack • Average Sequence Response Lag (b) • Smaller No. days: Firm fast to respond/attack MKT MKT PRICE MKT PRICE (a) (a) (b) Rival Firm PROD SVC
TMT Heterogeneity Variables • Educational Background • Blau’s index of heterogeneity for degree types (BBA, BSME, JD, etc.) • Industry Tenure • Coefficient of variation of TMT members’ years spent in the focal industry Data Source: D&B Reference Book of Corporate Management, 1987-93
Industry Variables • Industry Growth • Simple growth rate yeart yeart+1 • Industry Concentration • Herfindahl index • Barriers to Entry • Sum of industry means for R&D, SG&A, and total assets Data Source: COMPUSTAT Industry Segment Files, 1987-93
Influence of Firm and Industry Characteristics on Sequence Structure
Rivalry and Sequence Structure Unpredictable Faster Timing Differentiated Similar Extent of Rivalrous Differentiation
TMT Heterogeneity and Sequence Structure Industry Heterogeneity Unpredictable Complexity Educational Heterogeneity Heterogeneous Homogeneous Extent of TMT Heterogeneity
Industry Context and Sequence Structure Unpredictable Low Growth Low Barriers High Growth High Barriers
Strategic Repertoire Complexity and Performance Performance Simple Complex Extent of Elemental Complexity
Strategic Unpredictability and Performance Performance Routine Erratic Extent of Sequence Predictability
Strategic Pattern Differentiation and Performance Performance Similar Different Extent of Sequence Differentiation
Duration of Strategic Attack and Performance Performance Sustained Short Extent of Subsequence Duration
Conclusions:Sequence Matters Focal Firm Rival Firm • Sequence Structure • Predictability • Complexity • Timing • Duration • Firm Performance • Profitability • Sales growth • Market share
Implications:Synthesized Perspectives Competitive Dynamics Action Sequences Learning & Change Upper Echelons
Sequence Applications... COMPUTER PROGRAM: data actions2; subj = _n_; do i = 1 to max; output = matrix; end; run; DNA: BOXING: Jab...Jab…Uppercut LANGUAGE: qcheaTiueissesne. hsiT si a cesneueq. This is a sequence. CAGTACATAGTACGATACGA MUSIC: