cardea
Uploaded by
35 SLIDES
547 VUES
360LIKES

Competitive Interaction

DESCRIPTION

Competitive Interaction. Competitive Outcomes. Hardball?. Organizational Characteristics. Industry Characteristics. Dethronement of the Leader. Wal-Mart. Market Share. Sears. JC Penney. 1950 1960 1970 1980 1990 2000.

1 / 35

Télécharger la présentation

Competitive Interaction

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Competitive Interaction

  2. Competitive Outcomes Hardball? Organizational Characteristics Industry Characteristics

  3. Dethronement of the Leader Wal-Mart Market Share Sears JC Penney 1950 1960 1970 1980 1990 2000

  4. Dethronement of the Leader Market Share Boeing McDonnell- Douglass Airbus 1950 1960 1970 1980 1990 2000

  5. Dethronement of the Leader Market Share (U.S.) Nike Reebok Adidas 1980 1990 2005

  6. King of the Hill – Fizzy Beverages Market Share Other ? Coke Pepsi 1970 1980 1990 2000 2010 2020

  7. Simple Rivalry: Prisoner’s DilemmaWhat to say to police? Criminal 2 Confess Keep Quiet #2 Serves 10 Years in jail #1 Goes Free Both Serve 5 Years in Jail Confess Criminal 1 #1 Serves 10 Years in Jail #2 Goes Free Both Serve 1 Year in Jail Keep Quiet

  8. Three Stooges Larry, Moe, and Curley are in a 3-way duel and agree to take turns shooting each other, in that order Accuracy statistics: • Larry hits target 20% of the time • Moe hits target 80% of the time • Curley hits target 100% of the time When the duel starts, what should Larry do?

  9. Competitive Intelligence A systematic and ethical program for gathering information about competitors and general business trends to further your own company’s goals

  10. Play the Game Differently New market opportunity New customers Develop/leverage new value chain strengths New strategies/tactics New “flow” of the game Why CI? • Playing the Game Better • Focus on existing competitors/strategic position • Leverage value chain strengths • Incrementally improve existing strategies/tactics • Figuring out what drives behavior • Environment/industry drivers • Organizational drivers • Managerial drivers

  11. Competitor Intelligence Pyramid Recommendations Analysis of Data Sources of Data

  12. Industry experts/analysts Industry publications Trade shows/conferences Advertisements/PR University research centers Financial Court documents/patents Suppliers/customers Newspapers Help wanted ads Reverse engineering labs Competitor Intelligence Pyramid

  13. Your Rival’s News-based Competitive Actions July-October 2009 • Contract with Spike Lee for TV ad • Increase R&D budget by 30% • Buy warehouse facility near airport in Germany, Re-tool with robotic material handling system • License Oracle’s newest technology • Cut prices on older version of product by 33% • Endorsement contract with famous World Cup soccer athletes • Create multifunctional new product design team

  14. Reverse Engineering – Your Rival’s Product

  15. Value chain analysis Ratio analysis Benchmarking Cost analysis Trend analysis Personality profiling Wargaming or scenario planning Competitive behavior analysis Competitor Intelligence Pyramid

  16. Track Existing Rivals Anticipate New Rivals Inform Strategy: Identify own/competitor’s strengths/weaknesses Early warning system Plan of attack/retaliation Competitor Intelligence Pyramid

  17. The Cola Wars

  18. Competitive Action Repertoire The set of competitive actions carried out in a given time period Coke’s Market Share MKT CAP SIG PROD PRICE MKT MKT PROD Repertoire

  19. Your Rival’s Competitive Actions • Contract with famous movie director, Spike Lee, for TV ad • Increase R&D budget by 30% • Buy warehouse facility near airport in Germany, Re-tool with robotic material handling system • License Oracle’s newest technology • Cut prices on older version of product by 33% • Endorsement contract with famous U.S. Olympic athletes • Create multifunctional new product design team a b c d e

  20. Competitive Dynamics Analysis • Observe competitive moves • Organize competitive moves • Action/response pairs • Action repertoires (year-end tallies) • Competitive attacks/sequences • Measurement/Analysis of Characteristics • Action pattern characteristics that improve: • Market share • Stock price • Profitability

  21. Response Action Action-Reaction “Pairs” Action Pair 1 Action Pair 2 Action Pair 3 Action Pair 4 Coca-Cola d d c d Pepsi a c a e • Profits • Growth • Mkt. Share time

  22. Profits Growth Mkt. Share Total Actions Complexity Action “Repertoires” c c c Coca-Cola a a Year-End Tallies a c Pepsi d e time

  23. Strategy and Adaptive Maneuvering 8 7 6 5 4 3 2 1 • Chess: • Epaulette’s Mate • Sicilian Defense a b c d e f g h

  24. Sequence Applications... COMPUTER PROGRAM: data actions2; subj = _n_; do i = 1 to max; output = matrix; end; run; DNA: BOXING: Jab...Jab…Uppercut LANGUAGE: qcheaTiueissesne. hsiT si a cesneueq. This is a sequence. CAGTACATAGTACGATACGA MUSIC:

  25. Competitive Actions Over Time Coke Pepsi a a a b b b c c c d d e e d c e a a b a b c d e c b Observed Sequence Observed Sequence

  26. Coke Strategic Non-Conformity Coke Industry Norm a a a b b b c c c d d e e d c e a a b a b c d e c b Observed Sequence Observed Sequence

  27. Pepsi Strategic Conformity Pepsi Industry Norm a a a b b b c c c d d e e e a b d e c a a b c d c b Observed Sequence Observed Sequence

  28. Coke Strategic Unpredictability Coke in time1 Coke in time2 a a a b b b c c c d d e e a d a b c e d b b c c e a Observed Sequence Observed Sequence

  29. Pepsi Strategic Predictability Pepsi in time1 Pepsi in time2 a a a b b b c c c d d e e a d a b c e a d b c c e b Observed Sequence Observed Sequence

  30. King of the Hill – Fizzy Beverages Market Share Other ? Coke Pepsi 1950 1960 1970 1980 1990 2000

  31. “Hardball” Competition • Total Actions • More actions are better • Average Response Time • Faster response time is better • Repertoire Complexity • Complex repertoire is better • Attack [Un-]Predictability • Unpredictability is better

  32. Group Exercise: Coke vs. Pepsi • Total Actions • Count of total actions • Average Response Time • Avg. number of time units between last competitive move in Coke’s attack and Pepsi’s first competitive response, etc. • Repertoire Complexity • Extent to which entire pattern/repertoire is skewed/simple vs. balanced/complex • Attack [Un-]Predictability • Recognizable repetition or action combinations in the sequence of actions?

  33. Scoring the Fight Total Actions Faster Responses More Complex Repertoire Unpredictable Attacks CokePepsi Who will win?

  34. Rivals’ prior behavior Patterns Tendencies Type & order of moves Proactiveness Reactiveness Drivers of Behavior Management orientation Decision-making Financial constraints Industry characteristics Implications for CI:Predict Future Behavior of Rivals

  35. Implications for CI:Monitor Your Own Behavior • Objectively measures of competitive behavior • Safeguard against complacency, predictability, simplicity of your own company • Keep rivals off balance / disruption / guessing • What combinations of moves are effective? …which are ineffective? …smoke signals or bluffs?

More Related