1 / 1

Whole Genome Sequence for Cancer

Whole genome sequencing (WGS) is a key driver for many medical research projects in cancer and complex genetic disorders. Creative Biolabs has established the high-throughput SuPrecisionu2122 platform for large-scale sequencing services. Based on this advanced platform, we can provide the most comprehensive cancer WGS sequencing bioinformatics analysis for our global customers.

Shaw2
Télécharger la présentation

Whole Genome Sequence for Cancer

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. WHOLE GENOME SEQUENCING FOR CANCER WGS WorkFlow 1 ?????????????????????????????? ?????????????????????????????? ??????????????????????????? ???????????????????????????????? ?????????????????????????????? ???????? ??????? ????????????? ?????????????????????????????? ?? ????????? ????? ???? ?????????? ???? ?????????? ???? ??????? ???? ???????? ??? ??????? ??????? ??? ???????????????????????????????? ??????????????????????????????? ??? ??????????????? ??????????? ?????????? ??????? ??????????? ?????????? ?????? ??????????????? ??????? ???? ????? ?????????? ??? ?????????? ?????? ????? ??????? ????? ???? ??????? ???? ?????????? ???????? ??? ??????? ??????? ???? ???????????? ?????? ???? ?????????????????????????????? ????? ???? ????????????? ??? ???????????????????????????????? ???????????????????? ????????????? ????????????? ???????????????? ??????????????? ??????? CGTATCTAGGTACCCACGGACGATA CGTATCTAGGTACACACGGACGATA ???????? ???? ATAGTCGTATCTAAGTACC ATAGTCGTATCTAAGTACCCACGG ATAGTCGTATCTAAGTACCCACGGATGATA ????????? ????????? ???????? ????????????????????????????????? ?????????????????????????????? ?????????????????? ??? ??????? ???????? ???? ????????? ???????????????????????????? ATAGTCGTATCTAAGTACCCACGGATGATAGCTTACG CTAAGTACCCACGGATGATAGCTTACGCTA ????????? ??????????? TACCCACGGATGATAGCTTACGCTAAC ???????????? ??????????????????? ?????????????? ???????????????????????? ???????????????????? ???????????????????????????????? ????????????????????????????????? ??????????? ?????? ???? ?????? ???? ??????????????????????????????? ???????? ???????????????????? ??? ?????????? ???? ????????? ???? ??????????????????????????? ????????????????????? ??????????????????????????? ??????????????????????????????? ???????????????????????????? ??????????????? ??? ??????? ????? ?????????? ???? ??????????????? ??????????????????????????????? ???????????????????????? ?????????????????????? ??????????????????? ??????????????????? ??????????????????? Applications 2 ???????????????????? ????????????????? ??????????? ????????????????? ???????????????????? ????????????? ???????????????????? ??????????????????? ???? ???????????????????? ???????????????? ??????????????????? ?????????????????? ????????????????? ?????????? WHATWEDO: Whole Exome Sequencing (WES) Service Target Sequencing Service Whole Transcriptome Sequencing (WTS) Service Immune Repertoire Sequencing Service FEATURES: Up to 99.99% Accuracy Identify Potential Causative Variants Detect DNA Modifications without Bisulfite Treatment Identify Large Structural Variants Phase Alleles and Ariants Creative Biolabs Whole Genome Sequencing Service for Cancer © 2007 - 2019 Creative-Biolabs All Rights Reserved Email: info@creative-biolabs.com Tel: 1-631-381-2994

More Related