Studying differences/similarities in Individuals
Studying differences/similarities in Individuals. Methods used to study differences between individuals RFLP SNP DNA Repeats. Genetic polymorphism. Genetic Polymorphism: A difference in DNA sequence among individuals, groups, or populations.
Studying differences/similarities in Individuals
E N D
Presentation Transcript
Studying differences/similarities in Individuals Methods used to study differences between individuals RFLP SNP DNA Repeats
Genetic polymorphism • Genetic Polymorphism: A difference in DNA sequence among • individuals, groups, or populations. • Genetic mutations are a kind of genetic polymorphism. Genetic Variation Single nucleotide Polymorphism (point mutation) Repeat heterogeneity
Repeats and DNA fingerprint Variation between people- small DNA change – a single nucleotide polymorphism [SNP] – in a target site, RFLPs and point mutations are proof of variation at the DNA level. Satellite sequences: a short sequence of DNA repeated many times. Chr1 Interspersed Chr2 tandem
E E E E E E E E Repeats Satellite (large) (100->1000 bps long) Centromere/telomere Micro-satellite Extremely small repeats (2-5bp)- GCGCGCGC AGCAGCAGCAGC Mini-satellite- larger repeats (6-100 bp long) Chr2 3 1 4 0.5 Repeats can be dispersed or in tandem- tandem 2 5 6 Chr1
E E E E E E E E Mini Satellite Repeats and Blots Mini Satellite sequences: a short sequence (20-100bp long) of DNA repeated many times 2 5 6 Chr1 Chr2 3 1 4 0.5 tandem M M DNA DNA 7 7 5 5 3 3 Take Genomic DNA, Digest with EcoRI, Probe southern blot with repeat probe 1 1 DNA gel Blot
E E E E E E E E Mini Satellite Repeats and Blots Mini Satellite sequences: a short sequence (20-100bp long) of DNA repeated many times 2 5 6 Chr1 Chr2 3 1 4 0.5 tandem M M DNA DNA 7 7 5 5 3 3 Take Genomic DNA, Digest with EcoRI, Probe southern blot with repeat probe 1 1 DNA gel Blot
E E E E Repeat expansion/contraction Tandem repeats expand and contract during recombination. Mistakes in pairing leads to changes in tandem repeat numbers These can be detected by Southern blotting because as the number of repeats expand at a specific site, the restriction fragment at that site expands in size An allele of a mini-satellite varies by the number of repeats One repeat to many repeats- (varying in length from 0.5 to 20 kb) Chr1 Individual 1 4 Chr1 Individual 2 5 Ind1 Ind2 5 There are on average between 2 and 10 alleles (repeats) per mini-sat locus 3 1
E E E E Homozygous/heterozygous? Ind1 Ind2 Ind3 Chr1 Chr1 5 3 1
Micro-satellite and PCR Microsatellite repeat expansion and contraction is investigated using PCR and gels instead of gels and southern blots AGCGTCAGCGCGCGCTTATTGA TCGCAGTCGCGCGCGAATAACT AGCGTCAAATAACT 22 bp PCR fragment AGCGTCAGCGCGCGCGCGCGCTTATTGA TCGCAGTCGCGCGCGCGCGCGAATAACT AGCGTCAAATAACT 28 bp PCR fragment
DNA fingerprint 1 2 3 4 1 2 The use of microsatellite analysis in genetic profiling. In this example, 2 totally different microsatellites(1) and (2) located on the short arm of chromosome 6 have been amplified by the polymerase chain reaction (PCR). The PCR products are labeled with a blue or green fluorescent marker and run in a gel each lane showing the genetic profile of a different individual. Each individual has a different genetic profile because each person has a different number of microsatellite length repeats, the number of repeats giving rise to bands of different sizes after PCR. Locus1 locus2 Individual1 2,4 6,6 Individual2 2,6 1,4 Individual3 5,6 4,5
FBI and Microsatellite The FBI uses a set of 13 different microsatellite markers in forensic analysis. 13 sets of specific PCR primers are used to determine the allele present in the test sample for each marker. The marker used, the number of alleles at each marker and the probability of obtaining a random match for a marker is shown. How often would you expect an individual to be mis-identified if all 13 markers are analyzed Locus No. of alleles probability of random match A 11 0.112 B 19 0.036 C 7 0.081 D 7 0.195 E 10 0.062 F 10 0.075 G 10 0.158 H 11 0.065 I 10 0.067 J 8 0.085 K 8 0.089 L 15 0.028 M 20 0.039 P= 0.112x0.036x0.081x0.195x----- = = 1.7x10-15
DNA finger printing Variation between people- small DNA change – a single nucleotide polymorphism [SNP] – in a target site, RFLPs and SNPs are proof of variation at the DNA level, Satellite sequences: a short sequence of DNA repeated many times. Micro satellite are 2-5 bp repeats in tandem repeats 15-100 times in a row Mini satellite are 6-100 bp repeats in tandem (0.5 to 20kb long) Class size No of loci method Micro ~200bp 200,000 PCR Mini 0.2-20kb 30,000 southern blot SNP 1 bp 100 million PCR/microarray
DNA Fingerprint Analysis Case 1 Mr. Chan’s family consists of mom, dad and four kids. The parents have one daughter and one son together, another daughter is from the mother’s previous marriage, and the other son is adopted. Here are the DNA analysis results: • Which child is adopted? Why? • Which child is from the mother’s previous marriage? Why? • Who are the own children of Mr and Mrs Chan?
Answer Answers: • Child 4 is adopted. • Child 2 is the child from the mother’s previous marriage. • Child 1 and Child 3 are own children of Mr and Mrs Chan.
Activity 8.5 Case 2 A blood sample from a crime scene was collected. DNA samples of the victim and the potential suspects (June, Scarlet and John) were also collected for DNA analysis. The DNA profile is shown. Now, you should be able to identify the potential murderer.
Activity 8.5 Answers: • All of the DNA fragments of Scarlet can be found in the crime scene sample making her the most likely suspect.
Individuals Methods used to study differences between individuals DNA Repeats RFLP SNP
Very small Deletion/change (of a restriction site) E E E E E E 1kb 2kb 3kb 4kb 5kb 4.5kb 0.5kb 8kb 9kb GeneR GeneC GeneX GeneA H H 3kb Marker Marker Marker Marker EcoRI EcoRI WT Deletion
RFLP analysis RFLP= Restriction fragment length polymorphism Refers to variation (presence or absence) in restriction sites between individuals Because of mutations in Restriction sites These are extremely useful and valuable for geneticists (and lawyers) On average two individuals (humans) vary at 1bp in every 300-1000 bp The human genome is 3x109 bp This means that they will differ in more than 3 million bp!!! By chance these changes will CREATE or DESTROY the recognition sites for restriction enzymes
RFLP Lets generate a EcoRI map for the region in one individual 3kb 4kb The the same region of a second individual may appear as GAATTC GAATTC GAATTC 7kb Marker 1 2 GAATTC GAGTTC GAATTC Normal GAATTC Mutant GAGTTC EcoRI
RFLP The internal EcoRI site is missing in the second individual For X1 the sequence at this site is GAATTC CTTAAG This is the sequence recognized by EcoRI The equivalent site in the X2 individual is different GAGTTC CTCAAG This sequence IS NOT recognized by EcoRI and is therefore not cut Now if we examine a large number of humans at this site we may find that 25% possess the EcoRI site and 75% lack this site. We can say that a restriction fragment length polymorphism exits in this region These polymorphisms usually do not have any phenotypic consequences Silent mutations that do not alter the protein sequence because of redundancy in codon usage, localization in introns or non-genic regions
RFLP RFLP are identified by southern blots In the region of the human X chromosome, two forms of the X-chromosome are Segregating in the population. X1 B R R R B R 4 5 3 6 3.5 1 2 Digest DNA with EcoRI or BamHI and probe with Probe1/ probe2 What do we get? X2 B R R B R 8 4 6 3.5 1 2
RFLP in individuals If we used probe1 for southern blots with a BamHI digest what would be the results for X1/X1, X1/X2 and X2/X2 individuals? X1/X1 X1/X2 X2/X2 Probe1 BamHI 18 18 18 If we used probe1 for southern blots with a EcoRI digest what would be the results for X1/X1, X1/X2 and X2/X2 individuals? X1/X1 X1/X2 X2/X2 Probe1 EcoRI 5, 3 8, 5, 3 8 Probe2 EcoRI 9.5 9.5 9.5 X1 X2 4 4 5 8 3 6 6 3.5 3.5 B B R R R R R R B B R R 1 1 2 2
RFLP RFLP’s are found by trial and error They require an appropriate probe and appropriate enzyme They are very valuable because they can be used just like any other genetic marker to map genes They are employed in recombination analysis (mapping) in the same way as conventional morphological allele markers are employed The presence of a specific restriction site at a specific locus on one chromosome and its absence at a specific locus on another chromosome can be viewed as two allelic forms of a gene The phenotype in this case is a Southern blot rather than white eye/red eye 4 6 2 2 R R R R 1 X1 1 4 5 R R R 2 4 8 2 X2 1 2 4 3 R R R R R R R 1 2
X1 1 4 5 R R R 4 6 2 2 2 R R R R 1 X2 1 2 4 3 R R R R 2 Probe1 Probe2 6+2 8 X1/X1 individual 5 3 X2/X2 individual 4 8 2 R R R 1
Using RFLPs to map human disease genes 8 EcoRI Probe1 6 5 9 EcoRI Probe2 EcoRI Probe3 3 1 1 2 3 Which RFLP pattern segregates specifically with all of the diseased individual BUT NOT WITH NORMAL INDIVIDUALS? 1, 2 or 3 Which band segregates with the phenotype Top or bottom? Using DNA probes for different RFLPs you can screen individuals for a RFLP pattern that showsco-inheritance with the disease Conclusion: the actual mutation resides at or near RFLP1 bottom band
Mapping To map Two Genes, you perform crosses and measure recombination frequency between the two genes. Gene W and B are responsible for wing and bristle development W B Telomere Centromere To find the map distance between these two genes we need ALLELIC variants at each locus W=wings B=Bristles w= No wings b= no bristles To measure distance between these two genes, You do a TEST CROSS A double heterozygote is crossed to the double homozygote recessive wb/wb Males No wings No bristles WB/wb Female Wings Bristles X ----W--------B--- ----w--------b--- ----w--------b--- ----w--------b---
Mapping Male gamete (wb) Genotype phenotype WB WB/wb Wings Bristles 51 wb/wb No wings No bristles 43 Wb/wb Wings No bristles 3 wB/wb No wings Bristles 4 wb wb/wb Males No wings No bristles WB/wb Female Wings Bristles Wb Female gamete X wB Map distance= # recombinants /Total progeny 7/101= 7 M.U.
B 3 2 E E E b E 5 E RFLP Mapping Both the normal and mutant alleles of gene B (B and b) are sequenced and we find W B Telomere Centromere GAATTC AAATTC The mutation disrupts the sequence and alters a EcoRI site! If DNA is isolated from B/B, B/b and b/b individuals, cut with EcoRI and probed in A Southern blot, the pattern that we will obtain is B/B Bristle B/b Bristle b/b No bristle
Mapping To find the map distance between two genes we need ALLELIC variants at each locus Therefore in the cross (WB/wb x wb/wb), the genotype at the B locus can be distinguished either by the presence and absence of bristles OR by a Southern blot WB/wb x wb/wb Female Male WingsNo wings BristlesNo Bristles Southern blot: Southern blot: 5 and 2 kb band5 kb band You can use RFLPs instead of genes as markers along a chromosome Just like Genes, RFLPs mark specific positions on chromosomes and can be used for mapping.
Mapping Male gamete (wb) Genotype phenotype Parental WB WB/wb Wings 51 RFLP 5kb 2kb wb wb/wb No wings 43 RFLP 5kb 5kb Recombinant Wb Wb/wb Wings 3 RFLP 5kb 5kb wB wB/wb No wings 4 RFLP 5kb 2kb Female gamete Map distance= # recombinants /Total progeny 7/101= 7 M.U.
W B R Centromere Telomere Mapping To find the map distance between genes, multiple alleles are required. We know the distance between W and B by the classical method because multiple alleles exist at each locus (W & w, B & b). It is 7MU. We know the distance between B and R by the classical method as 20MU. 7MU 20MU C Now suppose you find a new gene C. You could map this gene with respect to Genes W, B and R using classical methods. However, what if it is difficult to study the function of this new gene (the phenotype is difficult to see with the naked eye) If the researcher identifies an RFLP in this gene you can map the gene mutation by simply following the RFLP.
W or w B or b RFLP1 Probe1 7kb or 4kb RFLP2 Probe2 1kb or 2kb RFLP3 Probe3 3kb or 9kb R or r Centromere Centromere Telomere Telomere Mapping Prior to RFLP analysis, only a few classical gene markers existed (approximately 200 in humans) Now over 7000 RFLPs have been mapped in the human genome. Newly inherited disorders are now mapped by determining whether they are linked to previously identified RFLPs 7MU 20MU
Individuals Methods used to study differences between individuals RFLP SNP DNA Repeats
Genetic polymorphism • Genetic Polymorphism: A difference in DNA sequence among • individuals, groups, or populations. • Genetic Mutation: A change in the nucleotide sequence of a • DNA molecule. • Genetic mutations are a subset of genetic polymorphism Genetic Variation Single nucleotide Polymorphism (point mutation) Repeat heterogeneity
SNP • A Single Nucleotide Polymorphism is a source variance in a genome. • A SNP ("snip") is a single base change in DNA. • SNPs are the most simple form and most common source of • genetic polymorphism in the human genome (90% of all human DNA polymorphisms). • There are two types of nucleotide base substitutions resulting in SNPs: • Transition: substitution between purines (A, G) or between pyrimidines (C, T). Constitute two thirds of all SNPs. • Transversion: substitution between a purine and a pyrimidine. • While a single base can change to all of the other three bases, most SNPs have only one allele.
SNPs- Single Nucleotide Polymorphisms -----------------------ACGGCTAA -----------------------ATGGCTAA Instead of using restriction enzymes, these are found by direct sequencing/PCR They are extremely useful for mapping Markers Classical Mendelian ~200 RFLPs 7000 SNPs 1.4x106 SNPs occur every 300-1000 bp along the 3 billion long human genome Many SNPs have no effect on cell function Note: RFLPs are a subclass of SNPs
SNPs Humans are genetically >99 per cent identical: it is the tiny percentage that is different Much of our genetic variation is caused by single-nucleotide differences in our DNA : these are called single nucleotide polymorphisms, or SNPs. As a result, each of us has a unique genotype that typically differs in about three million nucleotides from every other person. SNPs occur about once every 300-1000 base pairs in the genome, and the frequency of a particular polymorphism tends to remain stable in the population. Because only about 3 to 5 percent of a person's DNA sequence codes for the production of proteins, most SNPs are found outside of "coding sequences".
How did SNPs arise? F2a----ACGGACTGAC----CCTTACGTTG----TACTACGCAT---- | F1 ----ACTGACTGAC----CCTTACGTTG----TACTACGCAT---- P ----ACTGACTGAC----CCTTACGTTG----TACTACGCAT---- | F1 ----ACTGACTGAC----CCTTACGTTG----TACTAGGCAT---- | | F2b----ACTGACTGAC----CCATACGTTG----TACTAGGCAT---- Compare the two F2 progeny Haplotype1 (F2a) = SNP allele1 ----ACGGACTGAC----CCTTACGTTG----TACTACGCAT---- Haplotype2 (F2b) = SNP allele2 ----ACTGACTGAC----CCATACGTTG----TACTAGGCAT----
Each of 1013 cells in the human body receives approximately thousand DNA lesions per day (Lindahl and Barnes 2000) When these mutations are not repaired they are fixed in the genome of that particular cell If a mutation is fixed in germ cells that go on to be fertilized and form an embryo they will be propagated to progeny
SNPs, RFLPs, point mutations GAATTC GAATTC GAATTC GAATTC GAATTC GAATTC GAGTTC GAATTC GAATTC GACTTC RFLP SNP RFLP Pt mut SNP Pt mut SNP SNP
Coding Region SNPs • Types of coding region SNPs • Synonymous: the substitution causes no amino acid change to • the protein it produces. This is also called a silent mutation. • Non-Synonymous: the substitution results in an alteration of • the encoded amino acid. A missense mutation changes the • protein by causing a change of codon. A nonsense mutation • results in a misplaced termination. • More than half of all coding sequence SNPs result in • non-synonymous codon changes.
Alzheimer’s SNP Occasionally, a SNP may actually cause a disease. SNPs within a coding sequence are of particular interest to researchers because they are more likely to alter the biological function of a protein. One of the genes associated with Alzheimer's, apolipoprotein E or ApoE, is a good example of how SNPs affect disease development. This gene contains two SNPs that result in three possible alleles for this gene: E2, E3, and E4. Each allele differs by one DNA base, and the protein product of each gene differs by one amino acid. Each individual inherits one maternal copy of ApoE and one paternal copy of ApoE. Research has shown that an individual who inherits at least one E4 allele will have a greater chance of getting Alzheimer's. Apparently, the change of one amino acid in the E4 protein alters its structure and function enough to make disease development more likely. Inheriting the E2 allele, on the other hand, seems to indicate that an individual is less likely to develop Alzheimer's.
Intergenic SNPs Researchers have found that most SNPs are not responsible for a disease state because they are intergenic SNPs Instead, they serve as biological markers for pinpointing a disease on the human genome map, because they are usually located near a gene found to be associated with a certain disease. Scientists have long known that diseases caused by single genes and inherited according to the laws of Mendel are actually rare. Most common diseases, like diabetes, are caused by multiple genes. Finding all of these genes is a difficult task. Recently, there has been focus on the idea that all of the genes involved can be traced by using SNPs. By comparing the SNP patterns in affected and non-affected individuals—patients with diabetes and healthy controls, for example—scientists can catalogALL of the DNA sequence variations in affected Vs unaffected individuals to identify mutations that underlie susceptibility for diabetes GACTTC GAATTC GAGTTC GAATTC GAATTC RFLP SNP RFLP Pt mut SNP Pt mut SNP SNP
If a region of DNA has already been sequenced in one individual, the sequence information can be used to isolate and amplify that sequence from other individuals DNA in a population. Individuals with mutations in p53 are at risk for colon cancer To determine if an individual had such a mutation, prior to PCR one would have to clone the gene from the individual of interest (construct a genomic library, screen the library, isolate the clone and sequence the gene). With PCR, the gene can be isolated directly from DNA isolated from that individual. No lengthy cloning procedure necessary Only small amounts of genomic DNA required 30 rounds of amplification can give you >109 copies of a gene PCR
PCR 5’AAAGATCGGGGGGGGGGGGGGGTCGATCTA3’ 3’TTTCTAGCCCCCCCCCCCCCCCAGCTAGAT5’ Agarose Gel PRIMER1 5’AAAGATC3’ 3’AGCTAGAT5’ PRIMER2 5’AAAGATCGGGGGGGGGGGGGGGTCGATCTA3’ 3’AGCTAGAT5’ 5’AAAGATC3’ 3’TTTCTAGCCCCCCCCCCCCCCCAGCTAGAT5’ 5’AAAGATCGGGGGGGGGGGGGGGTCGATCTA3’ 3’TTTCTAGCCCCCCCCCCCCCCCAGCTAGAT5’ 5’AAAGATCGGGGGGGGGGGGGGGTCGATCTA3’ 3’TTTCTAGCCCCCCCCCCCCCCCAGCTAGAT5’
SNPs and Primers- ASO hybridization Individual 1 GACTCCTGAGGAGAAGTG Individual 2 GACTCCTGTGGAGAAGTG Raise Temperature Raise Temperature DNA from individuals 1 and 2 are tested under CONDITIONS that only allow perfect matches of oligos to anneal to the genomic DNA. 1 2
Mutants cannot be amplified WT 5’AAAGATCGGGGGGGGGGGGGGGTCGATCTA3’ 3’TTTCTAGCCCCCCCCCCCCCCCAGCTAGAT5’ Agarose Gel PRIMER1 5’AAAGATC3’ 3’AGCTAGAT5’ PRIMER2 3’AGCTAGAT5’ 5’AAAGATC3’ 5’AAAGATCGGGGGGGGGGGGGGGTCGATTTA3’ mut 3’TTTCTAGCCCCCCCCCCCCCCCAGCTAGAT5’ 5’AAAGATCGGGGGGGGGGGGGGGTCGATCTA3’ 3’AGCTAGAT5’ 5’AAAGATCGGGGGGGGGGGGGGGTCGATCTA3’ 3’TTTCTAGCCCCCCCCCCCCCCCAGCTAGAT5’
1 aAa aTa 2 cCc cGc 3 A A 4 G T 5 G G 6 T T 7 A G 8 T T 9 C G PCR allows only one SNP to be tested at a time Oligonucleotide chips contain thousands of short DNA sequences immobilised at different positions. Such chips can be used to discriminate between alternative bases at the site of a SNP. Chips allow many SNPs to be analyzed in parallel. Short DNA sequences on the chip represent all possible variations at a polymorphic site; A labeled genomic DNA from an individual will only stick if there is an exact match. The base is identified by the location of the fluorescent signal. Ind1 Ind2