1 / 1

B (LAI)

A. 10 20 30 40 50 60 70 80 90 ....|....| ....| ....| ....|....| ....|....| ....|....| ....|....| ....|....| ....|....| ....|....|

afi
Télécharger la présentation

B (LAI)

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. A 10 20 30 40 50 60 70 80 90 ....|....| ....| ....| ....|....| ....|....| ....|....| ....|....| ....|....| ....|....| ....|....| B(LAI)TCCGGAGTAC TTCAAGA.... .......... .........A CTGCTGACAT CGAGCTTGCT ACAA...GGG ACTTTCCGCT GGGGACTTT X ---------- -A---AG.... .......... .........- -------TGA A--AG--T-- -AC...T--- ---------- --------- B1 ------A--- -A---AG.... .......... .........- ----C----- ----.--T--- ---..G--- ---------- --------- B2_S ------A--T -A---AG.... .......... .........- ---------- ----.--T--- ---..G--- ---------- --------- B2_L --------TT -A-----ACTG CTGACGTCGA GTTACAGGG- ---------- ---A---T-CG --...G--- ---------- --------- AE ------A--- -AT--AG.... .......... .........- ---------A A--AG--T--- AC...TAA- ----.----- --------- 100 110 120 130 140 150 160 170 180 ....|....| ....|....| ....|....| ....|....| ....|....| ....|....| ....|....| ....|....| ....|....| B(LAI)CCA.GGGAGG CGTGGCCTGG GCGGGACT.G GGGAGTGGCG AGCCCTCAGA TCCTGCATAT AAGCAGCTGC TTTTTGCCTG TACTGGGTCT X ---.------ T--TA----- -----GT-.- ---------T -A-------- -G-------- -------C-- ----C--T-- ---------- B1 ---A------ T--------- --------.- ---------- ---------- -G-------- ---------- ---------- ---------- B2_S ---A------ T--------- --------.- ---------- ---------- -G-------- ---------- ----.----- ---------- B2_L ---.-A---- ----A-A--- --------.- ---------- -A-------- -G-------- ---------- ----.----- ---------- AE ---G------ T------G-- -T--AGT-.- --------TT -A-------- -G-------A -------C-- ----C--T-- ---------- 190 200 210 220 230 240 ....|....| ....|....| ....|....| ....|....| ....|....|....|....| ... B(LAI)CTCTGGTTAG ACCAGATCTG AGCCTGGGAG CTCTCTGGCT AACTAGGGAACCCACTGCTT AAG X ----A----- ---------- ---------- ---------- -G------------------ --- B1 ---------- --------A- ---------- ---------- G------------------- --- B2_S ---------- --------A- ---------- ---------- G------------------- --- B2_L ---------- ---------- ---------- ---------- -G------------------ --- AE ----T----- -----G--.- ----C----- ---------- -G-A---------------- --- BseAI TATAA-136 RBE III NF-κβII NF-κβI GABP AP1 SP1III SP1II SP1I CATATAA-30 E +1 BfrI CACCC-bi B C B (LAI) AE B1 B2_S B2_L X G G G G G G G G G G U U U U U G G G G G A A A A A C C C C C G G U G U U A C A A C C C C C U U U U U U U U A A A A A A C C C C C G C ∆G = -29.6 ∆G = -29.9 ∆G = -29.7 ∆G = -29.6 ∆G = -29.0 C ∆G = -29.7 C G U A U U U U C G U G G G A A U U G G C A G G G C G U C G U C A A G U G C C A A C U C G C G G G G C A G G C U G C C G U C A G C A U A C C A G U G U C U C U G G U U A G C U U U C U U C G C G C A G A C G A G G U G C A G G C C U G U U C G C U G G G A U U U C C A C G G A A A G C G U U U G G A U U C U A G C C C G G G U U C G U A G G G G U C C C A A C G C G A C A G G G C G A U G C C G U A C A G U G C U U G C C G U U U A G U G G C C C C A A A C A G C C U G C C U U U C A G G A G A A G G C G C A A U C G U G G C C C A C G U U G G A C G G U G G G G C U G C C C U C A U A U A

More Related