260 likes | 401 Vues
Chapter 12. Text book Notes. 12-1. TRANSFORMATION- process by which 1 strain of bacteria is altered due to the DNA of another bacteria… (p 288) How did we find out that this happens…?. 1928 Griffith: British scientist. Prob? How do bacteria make people sick?
E N D
Chapter 12 Text book Notes
12-1 • TRANSFORMATION- process by which 1 strain of bacteria is altered due to the DNA of another bacteria… (p 288) • How did we find out that this happens…?
1928 Griffith: British scientist • Prob? How do bacteria make people sick? • Specifically the bacteria pneumonia… • Materials: mice, syringe, diseased bacteria(A), healthy bacteria(B) • Results : (what do you think will happen- which bcateria will kill the mice?)
12-3 RNA & Protein Synthesis • Synthesis? • DNA instruction is in code • ATCCGGTTAAAGGTCCCTCTCTGATCCCGTATTAAAGTCGATTGACGATGCAGTGACGATGAAGTCGAAAACCGGTTGTGTGCCAGTGGCAGTGATG • Code controls the making of proteins (which control traits: ex blood type, flower color ) • QUESTION OF THE DAY: • How can we decode that message?
Decode Message • Message needs to go from nucleus to ribosomes….
Meet the RNA family … • mRNA travels to ribosomes • rRNA is present at the ribosomes • tRNA- transfers the amino acids to the ribosomes
Transcription • Step 1: mRNA goes over to the DNA in the nucleus, and finds the original strand • Step 2: mRNA looks only for the section that it needs to copy • Step 3: mRNA finds the section and copies it but in its own complementary language • Step 4: mRNA goes to Ribosome with message
Translation • Step 1: mRNA arrives at the ribosome, and rRNA is already there waiting…. • Step 2: mRNA and rRNA show the section of the code in codons in (mRNA language) to all the present tRNA’s • Step 3: the tRNA’s look at their anticodons, and see which codons they match. They will match their corresponding codons with the right amino acid. • Step 4: After a bunch of amino acids line up- proteins are made….
http://www.youtube.com/watch?v=983lhh20rGY • Video transcription and translation • Video replication • http://www.youtube.com/watch?v=hfZ8o9D1tus&feature=related
12-4 • Mutations: change in the genetic material • …. Now and again cells make mistakes in copying DNA
2 types of Mutations • Gene mutations • Chromosomal mutations
Gene Mutations • Occur on a single gene • TAC GCA TGG AAT • Code is read in 3 base codons • Thefatcatandratran- say?
3 types of gene mutations • Point Mutations occur at 1 spot • TAC GCA TGG AAT – original • Substitution? • Insertion? • Deletion ?
TAC GCA TGG AAT – original • Substitution • TAC GGA TGG AAT • Insertion • TAC GGC ATG GAA T • Deletion • TAC GAT GGA AT
Which are the 2 worst kinds of point mutations? Why? • THE FAT CAT RAN – original • Substitution • THH FAT CAT RAN • Insertion • THE FAA TCA TRA N • Deletion • HEF ATC ATR AN
Which are the 2 worst kinds of point mutations? Why? • Changes message which changes the amino acid that is made- wrong protein made …
Chromosomal Mutations • Changes in the … • Number of chromosomes • Down’s Syndrome • Or structure of chromosome • Deletion • Duplication • Inversion • Translocation
See chrom. Mut. Chart • http://www.pearsonsuccessnet.com/snpapp/iText/products/0-13-181118-5/ch12/sb7015a04.html
Deletion- 1 section is deleted • Duplication- 1 section is doubled • Inversion- 1 section is reversed • Translocation -part of one chromosome breaks off and attaches to another.
Mutations are good, bad or neutral • Neutral • Bad: cause dramatic changes in protein structure… body cannot function properly • Good.. Can create variability in species, can be beneficial, if environment • Ex- AIDS resistant gene • Polyploidy (extra chromosomes) • Banana and citrus fruits are larger and stronger