ajaxe
Uploaded by
26 SLIDES
406 VUES
260LIKES

Chapter 12

DESCRIPTION

Chapter 12. Text book Notes. 12-1. TRANSFORMATION- process by which 1 strain of bacteria is altered due to the DNA of another bacteria… (p 288) How did we find out that this happens…?. 1928 Griffith: British scientist. Prob? How do bacteria make people sick?

1 / 26

Télécharger la présentation

Chapter 12

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Chapter 12 Text book Notes

  2. 12-1 • TRANSFORMATION- process by which 1 strain of bacteria is altered due to the DNA of another bacteria… (p 288) • How did we find out that this happens…?

  3. 1928 Griffith: British scientist • Prob? How do bacteria make people sick? • Specifically the bacteria pneumonia… • Materials: mice, syringe, diseased bacteria(A), healthy bacteria(B) • Results : (what do you think will happen- which bcateria will kill the mice?)

  4. 12-3 RNA & Protein Synthesis • Synthesis? • DNA instruction is in code • ATCCGGTTAAAGGTCCCTCTCTGATCCCGTATTAAAGTCGATTGACGATGCAGTGACGATGAAGTCGAAAACCGGTTGTGTGCCAGTGGCAGTGATG • Code controls the making of proteins (which control traits: ex blood type, flower color ) • QUESTION OF THE DAY: • How can we decode that message?

  5. Decode Message • Message needs to go from nucleus to ribosomes….

  6. DNA vs RNA

  7. Meet the RNA family … • mRNA travels to ribosomes • rRNA is present at the ribosomes • tRNA- transfers the amino acids to the ribosomes

  8. Transcription • Step 1: mRNA goes over to the DNA in the nucleus, and finds the original strand • Step 2: mRNA looks only for the section that it needs to copy • Step 3: mRNA finds the section and copies it but in its own complementary language • Step 4: mRNA goes to Ribosome with message

  9. Translation • Step 1: mRNA arrives at the ribosome, and rRNA is already there waiting…. • Step 2: mRNA and rRNA show the section of the code in codons in (mRNA language) to all the present tRNA’s • Step 3: the tRNA’s look at their anticodons, and see which codons they match. They will match their corresponding codons with the right amino acid. • Step 4: After a bunch of amino acids line up- proteins are made….

  10. http://www.youtube.com/watch?v=983lhh20rGY • Video transcription and translation • Video replication • http://www.youtube.com/watch?v=hfZ8o9D1tus&feature=related

  11. 12-4 • Mutations: change in the genetic material • …. Now and again cells make mistakes in copying DNA

  12. 2 types of Mutations • Gene mutations • Chromosomal mutations

  13. Gene Mutations • Occur on a single gene • TAC GCA TGG AAT • Code is read in 3 base codons • Thefatcatandratran- say?

  14. 3 types of gene mutations • Point Mutations occur at 1 spot • TAC GCA TGG AAT – original • Substitution? • Insertion? • Deletion ?

  15. TAC GCA TGG AAT – original • Substitution • TAC GGA TGG AAT • Insertion • TAC GGC ATG GAA T • Deletion • TAC GAT GGA AT

  16. Which are the 2 worst kinds of point mutations? Why? • THE FAT CAT RAN – original • Substitution • THH FAT CAT RAN • Insertion • THE FAA TCA TRA N • Deletion • HEF ATC ATR AN

  17. Which are the 2 worst kinds of point mutations? Why? • Changes message which changes the amino acid that is made- wrong protein made …

  18. Chromosomal Mutations • Changes in the … • Number of chromosomes • Down’s Syndrome • Or structure of chromosome • Deletion • Duplication • Inversion • Translocation

  19. See chrom. Mut. Chart • http://www.pearsonsuccessnet.com/snpapp/iText/products/0-13-181118-5/ch12/sb7015a04.html

  20. Deletion- 1 section is deleted • Duplication- 1 section is doubled • Inversion- 1 section is reversed • Translocation -part of one chromosome breaks off and attaches to another.

  21. Mutations are good, bad or neutral • Neutral • Bad: cause dramatic changes in protein structure… body cannot function properly • Good.. Can create variability in species, can be beneficial, if environment • Ex- AIDS resistant gene • Polyploidy (extra chromosomes) • Banana and citrus fruits are larger and stronger

More Related