alton
Uploaded by
25 SLIDES
1119 VUES
400LIKES

Sequence information and file formats

DESCRIPTION

An Introduction to Bioinformatics. Sequence information and file formats. AIMS. To understand the conventions regarding the presentation of DNA and protein sequence information. To understand the logic underlying these conventions. To become familiar with the commonly used sequence file

1 / 25

Télécharger la présentation

Sequence information and file formats

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. An Introduction to Bioinformatics Sequence information and file formats

  2. AIMS To understand the conventions regarding the presentation of DNA and protein sequence information To understand the logic underlying these conventions To become familiar with the commonly used sequence file formats To become familiar with the READSEQ programme for the interconversion of file formats OBJECTIVES Present a nucleotide or protein sequence according to accepted conventions Recognize different sequence files formats Interconvert files between formats

  3. INTRODUCTION Virtually all the information one deals with in computational molecular biology is either in the form of DNA or protein sequences There are conventions applying to the presentation/storage of sequence information The way in which sequence information is stored, retrieved and manipulated varies There are different computer file types for sequence information

  4. DNA The DNA of living organisms is normally double stranded It is the convention to show only one strand of the DNA Which strand do you show? Which way round do you show it?

  5. The orientation of a DNA strand is determined by which end has a 5'-phosphate group and which has a 3'-hydroxyl group It is usually the case that either strand can be the template (or coding) strand at any particular point Given that the two strands are anti-parallel, the genes on the two strands will face in opposite directions

  6. RNA polymerase in all organisms moves along the template strand of the DNA in the 3'-5' direction producing RNA that grows in the 5'-3' direction The RNA sequence will be identical to that of the non- template strand, except for the presence of uracil instead of thymine 3’ GGCATAGCAGGTACGTTATGCCAGCATTG 5’ template 5’ CCGTATCGTCCATGCAATACGGTCGTAAC 3’ non-template 5’ CCGUAUCGUCCAUGCAAUACGGUCGUAAC 3’ mRNA The convention is to show the non-template strand of the DNA because it resembles the RNA

  7. For purely cultural reasons the sequence is shown running from right to left on the page, with the 5' end of the sequence on the right Sometimes when sequencing projects are in the draft state there are still ambiguities in the sequence IUPAC have defined a standard table for the nucleotide ambiguity codes

  8. PROTEIN Polypeptides have a polarity, with an N-terminal and C-terminal ends possessing a free amino group and carboxyl group respectively A polypeptide is presented with its N-terminus on the left of and its C-terminus on the right. H2N-Methionine-Valine-Tyrosine-Glycine-Isoleucine-Lysine-COOH To keep the polypeptide information in a form that can be conveniently handled by computers the amino acids are each given a single letter code

  9. Myoglobin

  10. H2N-Methionine-Valine-Tyrosine-Glycine-Isoleucine-Lysine-COOHH2N-Methionine-Valine-Tyrosine-Glycine-Isoleucine-Lysine-COOH MVYGIK

  11. FILE TYPES Many software packages have been developed for the analysis of DNA and protein sequences A variety of different file formats have been developed to store/analyse DNA and protein sequence information The various software packages will usually only accept a specific file format The situation is made worse by the fact that different databases hold the information in different file formats An essential skill is be able to recognize the different formats and to be able to interconvert files between formats

  12. Common File Formats IG/Stanford Fitch Plain/Raw GenBank/GBFasta/Pearson PIR/CODATA NBRF Zuker MSF EMBL Olsen ASN 1.8 GCG Phylip 3.2 PAUP/NEXUS DNAStrider Phylip Pretty

  13. PLAIN SEQUENCE FORMAT • A sequence in plain format may contain only IUPAC characters and • spaces (no numbers!). • Note: A file in plain sequence format may only contain one sequence, • while most other formats accept several sequences in one file. • An example sequence in plain format is: • AACCTGCGGAAGGATCATTACCGAGTGCGGGTCCTTTGGGCCCAA • CCTCCCATCCGTGTCTATTGTACCCTGTTGCTTCGGCGGGCCCGC • CGCTTGTCGGCCGCCGGGGGGGCGCCTCTGCCCCCCGGGCCCGTG • CCCGCCGGAGACCCCAACACGAACACTGTCTGAAAGCGTGCAGTC • TGAGTTGATTGAATGCAATCAGTTAAAACTTTCAACAATGGATCT

  14. FASTA FORMAT • A sequence file in FASTA format can contain several sequences. • One sequence in FASTA format begins with a single-line description, followed by • lines of sequence data. The description line must begin with a greater-than (">") • symbol in the first column. • An example sequence in FASTA format is: • >U03518 Aspergillus awamori internal transcribed spacer 1 (ITS1) • AACCTGCGGAAGGATCATTACCGAGTGCGGGTCCTTTGGGCCCAACCTCCCATCCGTGTCTATTGTACCC • TGTTGCTTCGGCGGGCCCGCCGCTTGTCGGCCGCCGGGGGGGCGCCTCTGCCCCCCGGGCCCGTGCCCGC • CGGAGACCCCAACACGAACACTGTCTGAAAGCGTGCAGTCTGAGTTGATTGAATGCAATCAGTTAAAACT • TTCAACAATGGATCTCTTGGTTCCGGC

  15. EMBL FORMAT • A sequence file in EMBL format can contain several sequences. • One sequence entry starts with an identifier line ("ID "), followed by further • annotation lines. The start of the sequence is marked by a line starting with "SQ" • and the end of the sequence is marked by two slashes ("//"). • An example sequence in EMBL format is: • ID AA03518 standard; DNA; FUN; 237 BP. • XX • AC U03518; • XX • DE Aspergillus awamori internal transcribed spacer 1 (ITS1) and 18S • DE rRNA and 5.8S rRNA genes, partial sequence. • XX • SQ Sequence 237 BP; 41 A; 77 C; 67 G; 52 T; 0 other; • aacctgcgga aggatcatta ccgagtgcgg gtcctttggg cccaacctcc catccgtgtc 60 • tattgtaccc tgttgcttcg gcgggcccgc cgcttgtcgg ccgccggggg ggcgcctctg 120 • ccccccgggc ccgtgcccgc cggagacccc aacacgaaca ctgtctgaaa gcgtgcagtc 180 • tgagttgatt gaatgcaatc agttaaaact ttcaacaatg gatctcttgg ttccggc 237 • //

  16. GENBANK FORMAT A sequence file in GenBank format can contain several sequences. One sequence in GenBank format starts with a line containing the word LOCUS and a number of annotation lines. The start of the sequence is marked by a line containing "ORIGIN" and the end of the sequence is marked by two slashes ("//"). An example sequence in GenBank format is: LOCUS AAU03518 237 bp DNA PLN 04-FEB-1995 DEFINITION Aspergillus awamori internal transcribed spacer 1 (ITS1) and 18S rRNA and 5.8S rRNA genes, partial sequence. ACCESSION U03518 BASE COUNT 41 a 77 c 67 g 52 t ORIGIN 1 aacctgcgga aggatcatta ccgagtgcgg gtcctttggg cccaacctcc catccgtgtc 61 tattgtaccc tgttgcttcg gcgggcccgc cgcttgtcgg ccgccggggg ggcgcctctg 121 ccccccgggc ccgtgcccgc cggagacccc aacacgaaca ctgtctgaaa gcgtgcagtc 181 tgagttgatt gaatgcaatc agttaaaact ttcaacaatg gatctcttgg ttccggc //

More Related