deron
Uploaded by
12 SLIDES
421 VUES
150LIKES

Sequence File formats and format conversion tools

DESCRIPTION

Sequence File formats and format conversion tools. Dinesh Gupta (ICGEB, New Delhi, India). Why different formats. Organised sequence information Database integration. Main file formats used in Bioinformatics. ASN.1 EMBL Swiss Prot FASTA GCG GenBank/GenPept Nexus PHYLIP

1 / 12

Download Presentation
Télécharger la présentation

Sequence File formats and format conversion tools

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Sequence File formats and format conversion tools • Dinesh Gupta (ICGEB, New Delhi, India)

  2. Why different formats • Organised sequence information • Database integration

  3. Main file formats used in Bioinformatics • ASN.1 • EMBL Swiss Prot • FASTA • GCG • GenBank/GenPept • Nexus • PHYLIP • NBRF and PIR

  4. ASN 1: Abstract Syntax Notation 1 used by NCBI Seq-entry ::= set { class phy-set , descr { pub { pub { article { title { name "Cross-species infection of blood parasites between resident and migratory songbirds in Africa" } , authors { names std { { name name { last "Waldenstroem" , first "Jonas" , initials "J." } } , { name name { last "Bensch" , first "Staffan" , initials "S." } } , { name name { last "Kiboi" , first "Sam" , initials "S." } } , { name name { last "Hasselquist" , first "Dennis" , initials "D." } } , { name name { last "Ottosson" , first "Ulf" , initials "U." } } } , affil std {

  5. EMBL/Swiss Prot (http://www.ebi.ac.uk/help/formats_frame.html) • The first line of each sequence entry is the ID definition line which contains entry name, dataclass, molecule, division and sequence length. • XX line contains no data, just a separator • The AC line lists the accession number. • DE line gives description about the sequence • FT precise annotation for the sequence • aa Sequence information SQ in the first two spaces. • The nucleotide sequence begins on the fifth line of the sequence entry. • The last line of each sequence entry in the file is a terminator line which has the two characters // in the first two spaces. • ID AA03518 standard; DNA; FUN; 237 BP. XX AC U03518; • XX • AC U03518; • XX • DE Aspergillus awamori internal transcribed spacer 1 (ITS1) and 18S • DE rRNA and 5.8S rRNA genes, partial sequence. • DE rRNA and 5.8S rRNA genes, partial sequence. • RX MEDLINE; 94303342. • RX PUBMED; 8030378. • XX • FT rRNA <1..20 • FT /product="18S ribosomal RNA" • FT misc_RNA 21..205 • FT /standard_name="Internal transcribed spacer 1 (ITS1)" • FT rRNA 206..>237 • FT /product="5.8S ribosomal RNA" • SQ Sequence 237 BP; 41 A; 77 C; 67 G; 52 T; 0 other; • aacctgcgga aggatcatta ccgagtgcgg gtcctttggg cccaacctcc catccgtgtc 60 • tattgtaccc tgttgcttcg gcgggcccgc cgcttgtcgg ccgccggggg ggcgcctctg 120 • ccccccgggc ccgtgcccgc cggagacccc aacacgaaca ctgtctgaaa gcgtgcagtc 180 • tgagttgatt gaatgcaatc agttaaaact ttcaacaatg gatctcttgg ttccggc 237 • //

  6. FASTA • A sequence in Fasta format begins with a single-line description, • followed by lines of sequence data. • The description line is distinguished from the sequence data by a greater-than (">") symbol in the first column. • It is recommended that all lines of text be shorter than 80 characters in length. • >U03518 Aspergillus awamori internal transcribed spacer 1 (ITS1) AACCTGCGGAAGGATCATTACCGAGTGCGGGTCCTTTGGGCCCAACCTCCCATCCGTGTCTATTGTACCC TGTTGCTTCGGCGGGCCCGCCGCTTGTCGGCCGCCGGGGGGGCGCCTCTGCCCCCCGGGCCCGTGCCCGC CGGAGACCCCAACACGAACACTGTCTGAAAGCGTGCAGTCTGAGTTGATTGAATGCAATCAGTTAAAACT TTCAACAATGGATCTCTTGGTTCCGGC

  7. GCG • Exactly one sequence • Begins with annotation lines • Start of the sequence is marked by a line ending with "..“ • This line also contains the sequence identifier, the sequence length and a checksum • ID AA03518 standard; DNA; FUN; 237 BP. • XX • AC U03518; • XX • DE Aspergillus awamori internal transcribed spacer 1 (ITS1) and 18S • DE rRNA and 5.8S rRNA genes, partial sequence. • XX • SQ Sequence 237 BP; 41 A; 77 C; 67 G; 52 T; 0 other; AA03518 Length: 237 Check: 4514 .. • 1 aacctgcgga aggatcatta ccgagtgcgg gtcctttggg cccaacctcc catccgtgtc • 61 tattgtaccc tgttgcttcg gcgggcccgc cgcttgtcgg ccgccggggg ggcgcctctg • 121 ccccccgggc ccgtgcccgc cggagacccc aacacgaaca ctgtctgaaa gcgtgcagtc • 181 tgagttgatt gaatgcaatc agttaaaact ttcaacaatg gatctcttgg ttccggc

  8. GenBank/GenPept The nucleotide (GenBank) and protein (Gen Pept) database entries are available from Entrez in this format • Can contain several sequences • One sequence starts with: “LOCUS” • The sequence starts with: "ORIGIN“ • The sequence ends with: "//“ • LOCUS AAU03518 237 bp DNA PLN 04-FEB-1995 • DEFINITION Aspergillus awamori internal transcribed spacer 1 (ITS1) and 18S • rRNA and 5.8S rRNA genes, partial sequence. • ACCESSION U03518 • BASE COUNT 41 a 77 c 67 g 52 t • ORIGIN • 1 aacctgcgga aggatcatta ccgagtgcgg gtcctttggg cccaacctcc catccgtgtc • 61 tattgtaccc tgttgcttcg gcgggcccgc cgcttgtcgg ccgccggggg ggcgcctctg • 121 ccccccgggc ccgtgcccgc cggagacccc aacacgaaca ctgtctgaaa gcgtgcagtc • 181 tgagttgatt gaatgcaatc agttaaaact ttcaacaatg gatctcttgg ttccggc • //

  9. NBRF (protein or nucleic acid) File Format The first line of each sequence entry begins with a greater than symbol, >. This is immediately followed by the two character sequence type specifier. Space four must contain a semi-colon. Beginning in space five is the sequence name or identification code for the NBRF database. The code is from four to six letters and numbers. Specifier Sequence type P1 protein, complete F1 protein, fragment DL DNA, linear DC DNA, circular RL RNA, linear RC RNA, circular N1 functional RNA, other than tRNA N3 tRNA The second line of each sequence entry contains two kinds of information. First is the sequence name which is separated from the organism or organelle name by the three character sequence blank space, dash, blank space, " - ". There is no special character marking the beginning of this line. Either the amino acid or nucleic acid sequence begins on line three and can begin in any space, including the first. The sequence is free format and may be interrupted by blanks for ease of reading. Protein sequences man contain special punctuation to indicate various indeterminacies in the sequence. In the NBRF data files all lines may be up to 500 characters long. However some PSC programs currently have a limit of 130 characters per line (including blanks), and BitNet will not accept lines of over eighty characters. The last character in the sequence must be an asterisks, *.

  10. ReadSeq Don Gilbert software@bio.indiana.edu, May 2001 Bioinformatics group, Biology Department & Cntr. Genomics & Bioinformatics, Indiana University, Bloomington, Indiana WWW http://bioportal.bic.nus.edu.sg/readseq/readseq.html http://www-bimas.cit.nih.gov/molbio/readseq/ http://bioweb.pasteur.fr/seqanal/interfaces/readseq-simple.html Seqret A program in EMBOSS suite

  11. The Readseq package can read most common formats: examples of all these formats are included in the readseq directory. The formats include: • IG/Stanford, used by Intelligenetics and others • GenBank/GB, genbank flatfile format • NBRF format (SAM modifications cause this to break when sequences do not have a terminating asterix) • EMBL, EMBL flatfile format • GCG, single sequence format of GCG software • DNAStrider, for common Mac program • Fitch format, limited use • Pearson/Fasta, a common format used by Fasta programs and others • Zuker format, limited use. Input only. • Olsen, format printed by Olsen VMS sequence editor. Input only. • Phylip3.2, sequential format for Phylip programs • Plain/Raw, sequence data only (no name, document, numbering) • MSF multi sequence format used by GCG software • PAUP's multiple sequence (NEXUS) format • PIR/CODATA format used by PIR

  12. Installation and running Readseqdownload from software directory from course homepagemkdir readseqcd readseqtar xvf readseq.tar./readseq --help./readseq <INPUT1> <INPUT2> -format=genbank -output = output.gb Exercises: Go to NCBI site and download a fasta formatted file (via Entrez: Nucleotide) Convert the file into EMBL, Phylip, MSF, etc. formats Download more files: can you work on multiple files ?

More Related
SlideServe
Audio
Live Player
Audio Wave
Play slide audio to activate visualizer