Kimberly S. Reece
Genetic Considerations in Broodstock Selection for Oyster Restoration, Aquaculture Development, and Non-native Species Introductions. Kimberly S. Reece. Virginia Oyster Landings 1880 - 2005. What is the best approach to restoration, protection and preservation of the oyster resource?.
Kimberly S. Reece
E N D
Presentation Transcript
Genetic Considerations in Broodstock Selection for Oyster Restoration, Aquaculture Development, and Non-native Species Introductions Kimberly S. Reece
What is the best approach to restoration, protection and preservation of the oyster resource?
Preferred Approach May Depend on Motivations and Perspectives What is the goal of oyster restoration? Industry Restoration-objective to become profitable and self-sustaining Ecological Restoration To restore habitat and populations of native oysters Develop a new oyster industry-aquaculture To rebuild a sustainableharvest fishery Non-native oyster Native oyster Not necessary exclusive approaches, but emphasis and measures of success may differ
Possible Solutions • Oyster reef restoration- build/restore habitat (reefs) and establish sanctuaries. • Reefs provide substrate for natural spatfall, sanctuaries protect from fishing pressure. • Stock reefs with oysters from hatcheries-goal self-sustaining • wild broodstock • selected / domesticated strains? • Aquaculture development through improved selective breeding practices: • Enhanced disease tolerance • Enhanced growth rate • Consideration of alternative Crassostrea species for Chesapeake Bay aquaculture and maybe restoration of the fishery (or ecological restoration). • Asian oysters are significantly more resistant (tolerant) to MSX and Dermo. • Crassostrea ariakensis tested in Chesapeake Bay has shown: • rapid growth • taste that is acceptable to market • disease tolerance in field trials
Genetic Considerations Stocking reefs with hatchery oysters Does it work? Is it a good idea from the genetics point of view? Which oysters to use? Wild or Selected? What is the genetic impact on extant natural populations? Ultimate goal = self-sustaining populations, but of what genetic make-up. Aquaculture Development Which oyster stocks to use? Diploids or triploids? Special genetic lines might be selected for particular traits of interest. Maintain genetically healthy lines. Is there any genetic impact on extant natural populations? Introduction of a Non-native Oyster Aquaculture or on bottom fishery? Which species? Genetic identification needed. Which stock? Broodstock source? Oregon strain too genetically bottlenecked?
Genetic Considerations (Restoration) Stocking reefs with hatchery oysters Does it work? Is it a good idea from the genetics point of view? Which oysters to use? Wild or Selected? What is the genetic impact on extant natural populations? Ultimate goal = self-sustaining populations, but of what genetic make-up?
I like a pale ale- 10 ppt Make mine a stout-30 ppt wild selected VIMS Should Reefs be Stocked? • Supportive breeding - adding hatchery broodstock to reefs to supplement natural populations. • If we do stock, what is the best broodstock? • Hatchery oysters from wild broodstock too wimpy? ie. Subject to high disease mortality? • Any selected line? • Different lines (or wild broodstock) be used for different systems/environments?
High Low Natural spatfall- natural populations Hatchery oysters from wild broodstock Selected lines Highly inbred lines Genetic variation The answer to the questions of whether to stock and with what, depends on: The genetic structure of the historical and the extant populations. The phenotypic relevance of any detected genetic variation. Is there local adaptation? The genetic impact of hatchery (planted) oysters on the wild populations and overall genetic variance (Ne).
Environmental change New stress/challenge: Do the disease-tolerant oysters, selected lines have a better chance of survival in the face of disease challenges? Maybe yes, in the short term, but what about longer term? Risks of inbreeding? Selected stock may not be able to survive different challenges-may really be “wimpy” under a different set of conditions. Inbreeding may lead to increasing deleterious allele frequencies = line crash
Environmental change = new stress/challenge and can results in elimination of some genetic types : Others may survive: Genetic diversity (higher effective population size) can be important for survival of a species Some “natural” populations are demonstrating disease tolerance. Maybe these are a better source for supportive breeding broodstock
June-September 2006: biweekly analysis of P. marinus in samples (each n = 25) of deployed DEBYs and naturally recruited C. virginica Shell Bar Reef, Great Wicomico River P. marinus Weighted Prevalence Carnegie and Burreson
York River-Disease Data • Cumulative mortality higher in Ross Rocks -- approaching 100% by September -- than in DEBYs (63% in October) • Cumulative mortality in Aberdeen Rocks (58% by October) similar to DEBYs; Wreck Shoals slightly higher (72%; MSX disease?) Carnegie and Burreson
Motivations for, and the risks of, supportive breeding- using selected/hatchery stocks for restoration efforts. • Motivations • Increase the chances of survival/reproduction in the face of disease. • Genetic rehabilitation-introgression of “disease resistance” alleles into natural populations. • Ability to genetically track the success and dispersal patterns at restored sites-experiments to help design/improve restoration strategies. • However, (the risks) • Calculations and analyses indicate population bottlenecking possible by deploying highly inbred selected lines (Hare and Rose) • Little evidence to date that the selected lines are doing well and reproducing. Are we wasting $? (Carlsson et al.--stay tuned) • Evidence of resistance (tolerance) in natural populations (Carnegie and Burreson), which are genetically more diverse and therefore risk can be reduced by using wild broodstock.
Need Basic Genetic Data Chesapeake Bay What is the Crassostrea virginica population genetic structure? Ongoing studies-published and preliminary results What is the effective population size in CB and how would selectively bred stock impact this? Matt Hare’s presentation on Thursday:high risk with current selected highly inbred lines with low Ne. What are the larval dispersal patterns around restored reefs? Ongoing studies-published and preliminary results
The BAYLOR SURVEY of OYSTER GROUNDS 1892 survey of most productive oyster grounds in Virginia (8 million bushels/year) Chesapeake Bay Oysters One panmictic population OR Isolated, genetically distinct populations? What is the genetic structure of the extant native oyster populations? What historically was the genetic structure of the native oyster populations?
One population, which over time declined to an extent that there are now individual populations that have become genetically isolated? Retentive/trap-like estuaries with low gene flow among systems?
Microsatellites +High power of discrimination for populations genetics and restoration monitoring +Highly variable +High throughput +Nuclear marker-biparentally inherited Microsatellite- simple sequence repeats often varying lengths among copies (alleles) ATCTATATATATATATATATATATCGTGG TCGATATATATATATATATATATAGCACC Chromosome (allele) from ♀ (TA)10 ATCTATATATATATATATATCGTGG TCGATATATATATATATATAGCACC Chromosome (allele) from ♂ (TA)8
Evidence of Genetic Structure in the Bay using Microsatellite Markers But Weak Structure Buroker et al. 1983. Evidence of differentiation using allozyme markers Rose, Paynter and Hare. 2006. J Hered. 97:158-170 Populations may be genetically different. There is evidence that more distant populations are more distinct.
Pairwise Comparisons of 10 Chesapeake Bay Populations Is structure relevant? Are populations locally adapted? 4 microsatellite markers Carlsson et al.
What happens to the oysters deployed on reefs? • Molecular markers to track deployed oysters. • Do they reproduce? • Genotype (genetically fingerprint) the spatfall. • Are progeny purebred deployed or wild oysters? • AND/OR • Hybrids? • Do the deployed oysters survive? How long? • Yearly genetic assessments of oysters at experimental deployment sites. • What impact do they have on surrounding populations? • Screening populations-follow through time.
Wild stocks Planted hatchery stocks Spat population: Progeny from wild, hatchery or hybrids? Are they more or less fit than wild? Molecular markers can help us discriminate among stocks/lines and allow us to learn more about the reef recruitment shadow and the results of the inter-breeding of wild and hatchery stocks.
Genetic analyses tracking the success of reef stocking Objective: Monitoring the breeding success, and longer-term relative survivability, of oysters planted on reefs Experiment designed for the Great Wicomico River system using the genetically unique, disease tolerant aquaculture strains (DEBYs). 7 6 5 4 3 2 1 Spat collected at sample sites every 2 weeks from June -October for genetic typing in the years 2002-2006.
GWR has been seeded multiple times over the years with several different stocks -06 Since 2002 primarily DEBY deployments as part of the experimental design to track success of planted oysters.
B A A Hinf I Digest of mt coIII in a Natural Population HinfI digest of mt coIII in DEBY strain Why did we choose DEBYs for the GWR experiment? DEBYs are genetically unique. Maternal signal-mtDNA. DEBYs Show High Frequency of Mitochondrial Haplotypes (DNA fingerprint patterns) that are Rare in Natural Chesapeake Bay Populations Frequency of the B alleles is relatively low in natural populations: <2%. Frequency of the B alleles is much higher in the DEBY stock, generally ranging from 25-50% depending on the spawn.
Microsatellite markers allow clear discrimination between hatchery lines and natural populations Deployed spat-on-shell - blue Rappahannock wild – yellow Example Rappahannock River, Drumming Ground
Mt DNA Analyses PRIOR TO DEPLOYMENT DEPLOYED DEBY PRODUCED SPAT AA BB Rare • Mt DNA and microsatellite analyses • 1579 spat collected in the summer of 2002 • 1 individual confidently assigned to DEBY • ~10% DEBY/WILD hybrids Hare et al. 2006- form Great Wicomico River 2002 Have the deployed DEBYs contributed significantly to spat production in GWR? Carlsson et al. Great Wicomico 2002-2006 Overall, data to date suggest that the DEBY contribution has been low: predation, poor survival and reproduction? Recently there have been much larger deployments with efforts and protecting plants and genetic signal needs to be followed over several years.
Genetic Considerations (Aquaculture) Aquaculture Development Which oyster stocks to use? Diploids or triploids? Special genetic lines might be selected for particular traits of interest. Maintain genetically healthy lines. Is there any genetic impact on extant natural populations? Genetic impact of aquaculture lines on natural populations is a concern in many aquatic systems. Eg. Salmonids But Is this a concern for aquaculture development in oysters?
Little evidence of genetic impact to date Analysis of oysters collected near two farms growing DEBYs Site 1 4 microsatellites 2 mtDNA genes Over 85% significantly not assigned to DEBY 1 individual assigned to DEBY Site 2 4 microsatellites 2 mtDNA genes Over 90% significantly not assigned to DEBY No individuals assigned to DEBY 1 DEBY (natural collection)
Allelic diversity of microsatellites reduced in DEBYS compared to natural populations DEBY strain Natural population There is evidence of reduced genetic variation in hatchery lines of C. virginica
Genetic Considerations (Introduction) Introduction of a Non-native Oyster Aquaculture or on bottom fishery? Which species? Genetic identification needed. Which stock? Broodstock source? Oregon strain too genetically bottlenecked?
1995 Virginia House of Delegates Resolution no. 450 “Requesting the Virginia Institute of Marine Science to develop a strategic plan for molluscan shellfish research and begin the process of seeking the necessary approvals for in water testing of non-native oyster species.” ICES Protocols The International Council for the Exploration of the Seas (ICES) Code of Practice on Introductions and Transfers of Marine Organisms (ICES, 1994): “…prior to any introduction a detailed analysis should be conducted on the ecological, genetic and diseaserelationships of the species in its natural range and environment.” EIS Currently Being Drafted
Genetic Analyses of Crassostrea ariakensis • Objectives: • Inventory of germplasm resources in the species, Crassostrea ariakensis-Correct identification of the species became a large concern. • To examine genetic variation and differentiation (population structure), among natural populations of the C. ariakensis from China, Korea and Japan • To examine genetic variability. • In US hatchery stocks (Oregon Strain) • Compared to wild source populations Jan Cordes and Jie Xiao Ximing Guo’s group-Rutgers
There is Genetic Variation among Wild C. ariakensis Populations linkage disequilibrium, and significant deviations from Hardy-Weinberg Equilibrium (HWE) Population pairwise Fst (above) and P-values (below). * indicates Non-significant values.
Genetic Variation among Wild Populations Factorial Correspondence Analysis (FCA) by Individuals KR YR DR IR
F1 “Oregon Strain” WC P1 Pacific Northwest, USA F1 Yellow River NCA WCA TUI SCA00 SCA99 F1 + Beihai US Hatchery Stocks Japan China
Genetic Variation in Hatchery Stocks vs. Wild Populations KR Factorial Correspondence Analysis (FCA) by Population YR IR DR TUI WCA SCA NCA
Hatchery Strains Wild Stocks 25 CarG110 CarG4-60 20 Car119-6a Car11-70 15 10 5 0 TUI WCA NCA SCA IR KR YR DR • Hatchery Stocks show reduction in genetic diversity compared to wild populations • Oregon strain is relatively highly inbred Wild Populations Allelic richness for four hatchery strains and four wild populations of C. ariakensis. Hatchery Stocks
Acknowledgements Stan Allen Roger Mann Missy Southworth Juli Harding Aimim Wang Dr. Wu Dr. Ahn Junya Higano Elizabeth Francis Georgeta Constantin Jie Xiao Qian Zhang Gail Scott Cheryl Morrison Pat Gaffney Sharon Furriness Francis O’Beirn Tommy Leggett Ryan Carnegie Mark Luckenbach Ken Paynter Matt Hare Don Merritt Wendi Ribeiro US National Sea Grant-ODRP NOAA/NMFS Chesapeake Bay Program Office Virginia Sea Grant College Program Chesapeake Bay Foundation US Army Corps of Engineers
Jan F.A. Cordes Jens A. Carlsson Research Assistant Scientists JAC ARSs