DNA Review: Structure, Replication, and Significance for Molecular Biology
Explore the double-stranded helix structure, DNA replication process, and the central role of DNA in molecular biology. Discover the importance of genes, transcription, and translation processes. Learn about enzymes involved in DNA replication and the significance of DNA structure for maintaining genetic information.
DNA Review: Structure, Replication, and Significance for Molecular Biology
E N D
Presentation Transcript
DNA Review • Nucleic acid • Double stranded helix • Monomer – nucleotide • Nucleotide – phosphate, deoxyribose sugar, nitrogenous base • Sugar phosphate backbone formed through bonds – what kind? • Each sugar attaches to 2 Phosphate confers directionality. • Nitrogenous bases interact via bond – what kind? Strong or weak? • www.ncbi.nlm.nih.gov/.../MolBioReview/dna2.htm
DNA Review • A-T, C-G which are purines, which are pyrimidines? • Antiparallel orientation • Torsion in helix and stacking of bases produce major and minor grooves Minor Groove Major Groove ghr.nlm.nih.gov/.../illustrations/dnastructure
Significance of DNA Structure • Maintenance of Code During Replication • A-T, C-G code retained during cell growth and division • Parent strands templates – code copied with fidelity • Provides Variety • Gene sequence of bases, genome collection of all DNA bases – responsible for uniqueness
DNA Replication • Duplication of DNA molecule – passed to progeny • How does it begin? • Signal triggers cell machinery – duplication of chromosome, in which phase? • Must occur in 1 life cycle • E. coli – once every 20 mins.
Enzymes of DNA Replication • Helicases - untwist and separate DNA strands • Topoisomerases - prevent breakage of DNA strands at fork due to torsion generated • Primase- RNA primer • DNA polymerase III – begins synthesis at primer • DNA polymerase I – chews up primer, replaces with DNA • DNA ligase – attaches fragments • Requires ~30 enzymes
DNA Replication • Begins at Ori • Helicases – unwind DNA and break apart two strands • Topoisomerases – prevent breaking • Each strand will be used as a template http://faculty.ircc.edu/FACULTY/TFischer/bio%201%20files/bio%201%20resources.htm
DNA Replication • Begins at Ori with RNA primer – primase • DNA pol III adds bases - Elongation -Synthesis of 2 daughter strands using template by DNA pol III in 5’ -> 3’ direction • Semiconsevative process • EXAMPLE: Give complementary strand 5’ AACTGCATGGGCCATTTTAAG 3’ TTGACGTACCCGGTAAAATTC http://faculty.ircc.edu/FACULTY/TFischer/bio%201%20files/bio%201%20resources.htm
DNA Replication • Leading and Lagging strand formed at each fork • Leading continuously formed • Lagging uses primer every 100-1000 bases to synthesis new fragment. • Okazaki fragments • DNA Pol I removes primer and adds bases • DNA ligase joins fragments • Forks meet ligase joins strands - termination http://lcvmwww.epfl.ch/~lcvm/dna_teaching_08_09/course_files/stasiak.html
Central Dogma of Molecular Biology • Genome full of info, but DNA does not perform cell processes • Exceptions – RNA viruses www.phschool.com/.../transcription/overview.html
Gene – Protein Connection • 3 Categories of Genes 1) Structural – protein 2) genes code for RNA 3) Regulatory – control gene expression - all three make up genotype (DNA) • Expressing of these make up phenotype • Review-Gene is DNA seq -> protein (a.a seq)-> 1 specific function (phenotype)
RNA • ss molecule, helix form, can form 2° and 3° structures due to H-bonds w/in molecule • U instead of T • Ribose instead of Deoxyribose • All RNA formed through Transcription, only mRNA Translated http://biology.kenyon.edu/courses/biol63/ribo/ribo.html
Types of RNA • mRNA- messenger RNA -transcript (copy) of gene -message read as triplets called codon 2) tRNA-transfer RNA -carries a.a. to ribosomes during translation -cloverleaf, 3 loops -bottom loop, anticodon 3) rRNA + protein = ribosome site of translation
Transcription: DNA -> RNA • Eukaryotes occurs in nucleus – Where is DNA? • Initiation – RNA polymerase recognizes and binds promoter region on DNA. • Elongation – DNA unwinds, RNA Pol synthesizes RNA molecule in 5’->3’ direction. • Termination – RNA Pol recognizes another seq. and releases DNA and mRNA transcript http://faculty.ircc.edu/faculty/tfischer/micro%20resources.htm
Reading the Message • mRNA encodes for a.a. sequence • Code is universal • Triplet = codon, 64 codons code for 20 a.a. 5’ AUG GUU CCC UAA 3’
Reading the Message • AUG is start codon • Example of mRNA: How many a.a.? 5’ AAAUGUUUCAAAAAUAAGA 3’ 4 – Methionine, Phenalanine, Glutamine, Lysine, Stop
Translation: mRNA -> Protein • Occurs at ribosomes in cytoplasm • Initiation: mRNA leaves DNA site, transported to ribosome 1) small subunit 30s binds mRNA, scans 5’->3’ for start codon 2) 1st charged tRNA carries fMet -Binds to mRNA via anticodon loop 3) large subunit 50s binds complex, provide enzymes that form peptide bonds, fMet in P site library.thinkquest.org/.../rna/index.html
Translation: mRNA -> Protein • Elongation: 1) 2nd charged tRNA enters A site, peptide bond formed 2) Complex shifts, uncharged tRNA leaves, open A site 3) next charged tRNA enters https://eapbiofield.wikispaces.com/17.2+and+17.4+Smith
Translation: mRNA -> Protein • Termination: Process repeated until stop codon, disassociation • Polyribosomes • Nearly 1200 ATP required for avg. protein http://kvhs.nbed.nb.ca/gallant/biology/translation_termination.html