1 / 26

S. cerevisiae 2.0

S. cerevisiae 2.0. Winston Retreat June 2006. so human read-able. so human use-able. Engineered Biological Systems Nature has optimized biology (“artifacts”) Technologies exist to optimize differently Try to re-engineer . so human read-able. Engineered Biological Systems

bernie
Télécharger la présentation

S. cerevisiae 2.0

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. S. cerevisiae 2.0 Winston Retreat June 2006

  2. so human read-able so human use-able • Engineered Biological Systems • Nature has optimized biology (“artifacts”) • Technologies exist to optimize differently • Try to re-engineer

  3. so human read-able • Engineered Biological Systems • Nature has optimized biology (“artifacts”) • Technologies exist to optimize differently • Try to re-engineer so human use-able • Of interest to biologists (test models) • chemists (atomic control of living systems) • technologists (biomaterials, energy, medicine) • re-writers

  4. Bacteriophage T7 39,937 base pairs 57 putative RBSs encoding 60 proteins 51 regulatory elements From D. Endy

  5. Previous Page Sequence (BNL) Dunn & Studier, J. Mol. Bio.166:477 (1983) From D. Endy

  6. Wild-Type T7 Genes 2.8-3 ----------------2.8-----------------> acgcaaagggaggcgacatggcaggttacggcgctaaaggaatccgaaa <--3-RBS---><----------------3-------------- From D. Endy

  7. Wild-Type T7 Genes 2.8-3 ----------------2.8-----------------> acgcaaagggaggcgacatggcaggttacggcgctaaaggaatccgaaa <--3-RBS---><----------------3-------------- T7.1 Parts 28 & 29 acgcaaGgggagAcgacaCggcaggttacggcgctaaggatccggccgcaaagggaggcgacatggcaggttacggcgctaaa ----------------2.8-----------------><D28R|D29L><--3RBS------><---------------3---- From D. Endy

  8. Genome design algorithm T7 39,937 bps 57 putative RBSs encoding 60 proteins 51 regulatory elements T7.1 41,326 bps 73 “parts” From S. Kosuri, D. Endy

  9. http://parts.mit.edu/

  10. Refactor[1-12,179]:T7+ Wild-Type T7 (T7+) From D. Endy

  11. Two yeast rewrites mtDNA re-org SAGA swap 1. = http://www.mbg.cornell.edu/MBG_Faculty_Detail.cfm?id=10 2. = from Suzanne Berger to NAS 05/15/06

  12. mtDNA re-org mt DNA 85,779 bps 8 verified protein encoding genes 24 tRNA genes 2 rRNA genes ~20 nucleic acid processing factors encoded by introns http://db.yeastgenome.org/cgi-bin/gbrowse/yeast/?name=chrMito%3A1..85779

  13. mtDNA re-org COX1, ATP8, ATP6, COB, OLI1, VAR1, COX2, COX3, 8 proteins (7 for ox phos, 1 mt ribosome) 11 dubious ORFs http://db.yeastgenome.org/cgi-bin/gbrowse/yeast/?name=chrMito%3A1..85779

  14. one Crick tRNA mtDNA re-org 15S rRNA 21S rRNA intron encodes I-Sce enzyme http://db.yeastgenome.org/cgi-bin/gbrowse/yeast/?name=chrMito%3A1..85779

  15. mtDNA re-org Design 2.0 8 protein ORFs 2 rRNAs 25 tRNAs reduces genome by ~ 4.7 kb • Design 3.0 might also remove introns • reduces genome by ~20.5 kb • lose ~20 nucleic acid modifiers • might regulate with T7 RNAP instead of RPO41 and MTF1

  16. mtDNA re-org Execution 2.0 http://images.google.com/imgres?imgurl=http://transplant.sinica.edu.tw/data/pds.jpg&imgrefurl=http://transplant.sinica.edu.tw/data/pds.html&h=323&w=307&sz=33&tbnid=9iaDZP47jhgGYM:&tbnh=114&tbnw=108&hl=en&start=1&prev=/images%3Fq%3DPDS1000/He%26svnum%3D10%26hl%3Den%26lr%3D%26sa%3DN

  17. SAGA swap Ada1 Ada2 Ada3 Gcn5 Spt3 Spt7 Spt8 Spt20 Taf5 Taf6 Taf9 Taf10 Taf12 Tra1 Sgf73 Sgf29 Sgf11 Ubp8 Sus1 from Wu Mol Cell (2004) 15:199

  18. SAGA swap essent’l genes? Ada1 Ada2 Ada3 Gcn5 Spt3 Spt7 Spt8 Spt20 Taf5 Taf6 Taf9 Taf10 Taf12 Tra1 Sgf73 Sgf29 Sgf11 Ubp8 Sus1 from Wu Mol Cell (2004) 15:199

  19. SAGA swap HAT? Ada1 Ada2 Ada3 Gcn5 Spt3 Spt7 Spt8 Spt20 Taf5 Taf6 Taf9 Taf10 Taf12 Tra1 Sgf73 Sgf29 Sgf11 Ubp8 Sus1 from Wu Mol Cell (2004) 15:199

  20. SAGA swap HAT+TBPreg? Ada1 Ada2 Ada3 Gcn5 Spt3 Spt7 Spt8 Spt20 Taf5 Taf6 Taf9 Taf10 Taf12 Tra1 Sgf73 Sgf29 Sgf11 Ubp8 Sus1 from Wu Mol Cell (2004) 15:199

  21. SAGA swap txn reg? Ada1 Ada2 Ada3 Gcn5 Spt3 Spt7 Spt8 Spt20 Taf5 Taf6 Taf9 Taf10 Taf12 Tra1 Sgf73 Sgf29 Sgf11 Ubp8 Sus1 from Wu Mol Cell (2004) 15:199

  22. SAGA swap HAT+neighbor? Ada1 Ada2 Ada3 Gcn5 Spt3 Spt7 Spt8 Spt20 Taf5 Taf6 Taf9 Taf10 Taf12 Tra1 Sgf73 Sgf29 Sgf11 Ubp8 Sus1 from Wu Mol Cell (2004) 15:199

  23. SAGA swap core subunits? Ada1 Ada2 Ada3 Gcn5 Spt3 Spt7 Spt8 Spt20 Taf5 Taf6 Taf9 Taf10 Taf12 Tra1 Sgf73 Sgf29 Sgf11 Ubp8 Sus1 from Wu Mol Cell (2004) 15:199

  24. SAGA swap Ada1 Ada2 Ada3 Gcn5 Spt3 Spt7 Spt8 Spt20 Taf5 Taf6 Taf9 Taf10 Taf12 Tra1 Sgf73 Sgf29 Sgf11 Ubp8 Sus1 from Wu Mol Cell (2004) 15:199

  25. the end “Break something”

More Related