260 likes | 279 Vues
Explore the possibility of re-engineering biological systems to optimize them for human usability and readability. This includes studying engineered biological systems, optimizing biology through technology, and re-writing genetic code for human applications.
E N D
S. cerevisiae 2.0 Winston Retreat June 2006
so human read-able so human use-able • Engineered Biological Systems • Nature has optimized biology (“artifacts”) • Technologies exist to optimize differently • Try to re-engineer
so human read-able • Engineered Biological Systems • Nature has optimized biology (“artifacts”) • Technologies exist to optimize differently • Try to re-engineer so human use-able • Of interest to biologists (test models) • chemists (atomic control of living systems) • technologists (biomaterials, energy, medicine) • re-writers
Bacteriophage T7 39,937 base pairs 57 putative RBSs encoding 60 proteins 51 regulatory elements From D. Endy
Previous Page Sequence (BNL) Dunn & Studier, J. Mol. Bio.166:477 (1983) From D. Endy
Wild-Type T7 Genes 2.8-3 ----------------2.8-----------------> acgcaaagggaggcgacatggcaggttacggcgctaaaggaatccgaaa <--3-RBS---><----------------3-------------- From D. Endy
Wild-Type T7 Genes 2.8-3 ----------------2.8-----------------> acgcaaagggaggcgacatggcaggttacggcgctaaaggaatccgaaa <--3-RBS---><----------------3-------------- T7.1 Parts 28 & 29 acgcaaGgggagAcgacaCggcaggttacggcgctaaggatccggccgcaaagggaggcgacatggcaggttacggcgctaaa ----------------2.8-----------------><D28R|D29L><--3RBS------><---------------3---- From D. Endy
Genome design algorithm T7 39,937 bps 57 putative RBSs encoding 60 proteins 51 regulatory elements T7.1 41,326 bps 73 “parts” From S. Kosuri, D. Endy
Refactor[1-12,179]:T7+ Wild-Type T7 (T7+) From D. Endy
Two yeast rewrites mtDNA re-org SAGA swap 1. = http://www.mbg.cornell.edu/MBG_Faculty_Detail.cfm?id=10 2. = from Suzanne Berger to NAS 05/15/06
mtDNA re-org mt DNA 85,779 bps 8 verified protein encoding genes 24 tRNA genes 2 rRNA genes ~20 nucleic acid processing factors encoded by introns http://db.yeastgenome.org/cgi-bin/gbrowse/yeast/?name=chrMito%3A1..85779
mtDNA re-org COX1, ATP8, ATP6, COB, OLI1, VAR1, COX2, COX3, 8 proteins (7 for ox phos, 1 mt ribosome) 11 dubious ORFs http://db.yeastgenome.org/cgi-bin/gbrowse/yeast/?name=chrMito%3A1..85779
one Crick tRNA mtDNA re-org 15S rRNA 21S rRNA intron encodes I-Sce enzyme http://db.yeastgenome.org/cgi-bin/gbrowse/yeast/?name=chrMito%3A1..85779
mtDNA re-org Design 2.0 8 protein ORFs 2 rRNAs 25 tRNAs reduces genome by ~ 4.7 kb • Design 3.0 might also remove introns • reduces genome by ~20.5 kb • lose ~20 nucleic acid modifiers • might regulate with T7 RNAP instead of RPO41 and MTF1
mtDNA re-org Execution 2.0 http://images.google.com/imgres?imgurl=http://transplant.sinica.edu.tw/data/pds.jpg&imgrefurl=http://transplant.sinica.edu.tw/data/pds.html&h=323&w=307&sz=33&tbnid=9iaDZP47jhgGYM:&tbnh=114&tbnw=108&hl=en&start=1&prev=/images%3Fq%3DPDS1000/He%26svnum%3D10%26hl%3Den%26lr%3D%26sa%3DN
SAGA swap Ada1 Ada2 Ada3 Gcn5 Spt3 Spt7 Spt8 Spt20 Taf5 Taf6 Taf9 Taf10 Taf12 Tra1 Sgf73 Sgf29 Sgf11 Ubp8 Sus1 from Wu Mol Cell (2004) 15:199
SAGA swap essent’l genes? Ada1 Ada2 Ada3 Gcn5 Spt3 Spt7 Spt8 Spt20 Taf5 Taf6 Taf9 Taf10 Taf12 Tra1 Sgf73 Sgf29 Sgf11 Ubp8 Sus1 from Wu Mol Cell (2004) 15:199
SAGA swap HAT? Ada1 Ada2 Ada3 Gcn5 Spt3 Spt7 Spt8 Spt20 Taf5 Taf6 Taf9 Taf10 Taf12 Tra1 Sgf73 Sgf29 Sgf11 Ubp8 Sus1 from Wu Mol Cell (2004) 15:199
SAGA swap HAT+TBPreg? Ada1 Ada2 Ada3 Gcn5 Spt3 Spt7 Spt8 Spt20 Taf5 Taf6 Taf9 Taf10 Taf12 Tra1 Sgf73 Sgf29 Sgf11 Ubp8 Sus1 from Wu Mol Cell (2004) 15:199
SAGA swap txn reg? Ada1 Ada2 Ada3 Gcn5 Spt3 Spt7 Spt8 Spt20 Taf5 Taf6 Taf9 Taf10 Taf12 Tra1 Sgf73 Sgf29 Sgf11 Ubp8 Sus1 from Wu Mol Cell (2004) 15:199
SAGA swap HAT+neighbor? Ada1 Ada2 Ada3 Gcn5 Spt3 Spt7 Spt8 Spt20 Taf5 Taf6 Taf9 Taf10 Taf12 Tra1 Sgf73 Sgf29 Sgf11 Ubp8 Sus1 from Wu Mol Cell (2004) 15:199
SAGA swap core subunits? Ada1 Ada2 Ada3 Gcn5 Spt3 Spt7 Spt8 Spt20 Taf5 Taf6 Taf9 Taf10 Taf12 Tra1 Sgf73 Sgf29 Sgf11 Ubp8 Sus1 from Wu Mol Cell (2004) 15:199
SAGA swap Ada1 Ada2 Ada3 Gcn5 Spt3 Spt7 Spt8 Spt20 Taf5 Taf6 Taf9 Taf10 Taf12 Tra1 Sgf73 Sgf29 Sgf11 Ubp8 Sus1 from Wu Mol Cell (2004) 15:199
the end “Break something”