brencis
Uploaded by
69 SLIDES
1360 VUES
760LIKES

Conservation Genetics

DESCRIPTION

Conservation Genetics. 6080 Fall 2009. We will talk about genetics from two perspectives. First, we will talk about how genetics influences the viability of populations, both now and in the sense of adaptation to future change.

1 / 69

Télécharger la présentation

Conservation Genetics

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Conservation Genetics 6080 Fall 2009

  2. We will talk about genetics from two perspectives. First, we will talk about how genetics influences the viability of populations, both now and in the sense of adaptation to future change. Second, we will talk about how genetic tools provide new insight into conservation problems and what new conservation policy may arise.

  3. What to count? Nc= number of individuals Or Ne= genetically effective population

  4. From a genetics perspective Know WHAT to count..genetic effective population size Ne • Populations are smaller than they seem • Genetic diversity is lost as Ne declines, not just Nc • Ne reduced by many things, e.g., unequal sex ratio, mating structure, population fragmentation, age-related disease (Ebola), etc. etc.

  5. Genetically effective population • The genetically effective population (N with subscript e,  Ne) is the number of individuals in a population that contribute genes to the next generation. • It is usually less, and often much less, than the census population (Nc).

  6. It is influenced by age structure, sex ratio, social structure, and especially by spatial structure. Metapopulation structure may enhance population viability but it may also contribute to loss of genetic variation by reducing Ne. Genetic models typically use Ne rather than Nc. • Loss in heterozygosity depends on Ne not Nc

  7. First, a conservation crisis and a genetics enigma

  8. All the remaining individuals of the Great and Lesser Apes would fit into a couple of football stadiums (IUCN Red Book 2007) Ebola virus in Africa (made worse by war, habitat loss (logging and oil palm), bushmeat, poaching, etc.) Ne =?????

  9. The enigma of viruses • Cause of many diseases that threaten species (plants and animals). • Total number of viral types is huge. • Viruses, especially single strand RNA viruses, have very high mutation rates. • Viruses are obviously successful yet many have as few as five genes. Ebola has only 15 genes.

  10. Viral enigma • With high mutation rates and few genes how do they adapt to host immune defenses????

  11. AND…effects of genetic change on ecosystems

  12. A species’ pool of genetic diversity exists at three fundamental levels

  13. What can you learn about populations from measuring levels of heterozygosity?First, you have to know what is “normal” or average for the taxon.

  14. Among population genetic diversity (Dpt) What can it tell you? Above average for taxon: Unusual spatial segregation; low mobility; high site fidelity (Red Cockaded Woodpeckers, Howler monkeys); farther from “ideal” breeding population Nc much Higher than Ne Below average for taxon: Unusual high migration; panmixis; closer to “ideal” breeding population Nc close to Ne

  15. Heterozygosity • Some genetically identical populations do well (Northern Elephant Seal) others not (Cheetahs) • Rate of decline in heterozygosity is extremely important

  16. Hairy-Nosed Wombat. Is 65 enough to survive? What can genetics tell us? If these populations can increase, are these numbers good insurance against extinction? Must also consider genetic variation. 1000 Kemp’s Ridley Turtle? 300 Right Whales?

  17. Population bottlenecks and reduced genetic variation Genes lost through drift Slower recovery of genetic variation More homozygosity

  18. .. Lost uncommon black allele

  19. Rare alleles more likely lost in small populations (genetic drift)

  20. Galapagos tortoise population on Volcan alcedo suffered severe bottleneck about time of massive eruption (molecular clock and geological evidence). Population has less genetic variation than other populations but population has recovered.

  21. American bison, a bottleneck enigma? At time of European contact, bison estimate was about 60,000,000 By 1890 it was about 750 By 2000 the number was about 360,000 Bison have considerable genetic variation (within and between population heterozygosity). How did they retain so much genetic variation??? Hint: geographic herds and buffalo parks.

  22. Some, but not all, inbred populations have lower fitness due to expression of deleterious genes

  23. Deleterious genes are usually recessive. So in more homozygous inbred populations they are more likely to occur at the same locus.

  24. Inbred white-footed mice (open circles) had lower survivorship than outbred individuals (solid circles) after release into the wild

  25. Inbreeding depression Vulnerable small populations Population of 40 European Adders was isolated by road. In a few years malformed individuals and lower birth rates began to cause population decline. This is an example of inbreeding depression. Population growth was restored when individuals from different population were introduced.

  26. Not all alleles are equal • MHC (major histocompatibility complex) genes enhance immune response. Located on chromosome 6 in humans. • Heterozygous MHC generates more types of immune molecules and therefore is more “adaptive” to counter diverse pathogens.

  27. Intracellular diversity of MHC is important • MHC codes for large proteins that transport viral particles to surface and holds them for T-cells (killer cells) • Viral diversity is best delt with by diversity of MHC proteins • Trade-off is that large proteins are costly to make. Therefore…..?

  28. African Cheetahs, wild and in zoos, are highly inbred with little genetic variation. A feline viral disease swept through European zoos killing many cheetahs. Lions have much greater genetic variation and were relatively unaffected by the disease.

  29. Many domesticated plants and animals, especially pets, are highly inbred

  30. …and some people. Why states outlaw marriage between close relatives.

  31. Charles II of Spain illustrates the Hapsburg lip, an Inbred trait in this royal line.

  32. Severe effects of inbreeding in zoo tiger

  33. Bottleneck consequences • More deleterious genes expressed by more homozygosity means very slow recovery or extinction (African Cheetah) • Fewer deleterious genes means fast recovery (N. Elephant Seal) • Recovery from bottleneck may reduce future inbreeding effects. • Founder effect from migrants from small population

  34. Genetics as a tool for conservation management

  35. Genetics provides new insight • Pacific Gray Whales thought to be recovery success at 22,000 current Nc • But, 10% whales are undernourished • Calving frequency is down • Feeding behavior has shifted from “bottom plowing” (which supports sea birds) to feeding in water column

  36. Pacific Gray Whale: Using Genetics to Infer the Past

  37. Gray whales migrate from winter feeding area to southern mating and breeding site. Longest mammal migration.

  38. Pit marks left by whale foraging. Currently re-suspend about 172 million tons each year. More than 2X that produced by the Yukon River, the 3rd largest US river. Nutrients support fish and food for sea birds.

  39. Recovery to 22,000. A success story?

  40. Gray whale con’t • Genetic variation between individuals indicates much larger population in past (mismatch analysis of sequence frequencies) • Accounts from 1700s indicates large whale populations. Their “fetid breath fouled Monterey Bay..” Calif. Bishop

  41. Gray whale con’t • Decline in plankton, plankton-feeding fish and the birds that eat those fish suggests a decline in productivity • Probably related to global warming and temperature increase in coastal waters • Thus, Gray Whales may not be at historic carrying capacity but rather the environment is changing to their detriment.

  42. Gray whale con’t • Genetic information suggests an early population between 78,500-117,000 • These populations would have disturbed between 22-31% of the sea sediment each year • …and the effect from this nutrient input on birds and fish??

  43. Grizzly bears: what genetic tools can tell us • The size of the population • The sex ratio • Migration Done through the use of microsatellite markers.

  44. Note: DNA alphabet has only four “letters” A,C,T,G and these can only pair AT, CG

  45. Microsatellite is a repetitive sequence of 1-6 base pairs on single strand of DNA Individual one: Two microsatellites. 7AC and 3ACT ACTAGACACACACACACACTAGCGACCTACTACTACTAG Individual two: Two microsatellites. 6AC and 3ACT ACTAGACACACACACACTAGCGACCTACTACTACTAG In practice, many microsatellites are needed to create individual genetic fingerprints, i.e. to identify individuals. But fewer needed to identify species or geographic populations.

  46. Grizzly bear range in lower 48 states

More Related