brendanc
Uploaded by
21 SLIDES
229 VUES
210LIKES

Finding substrings

DESCRIPTION

Learn how to utilize Perl's =~ operator for substring search, replacement, and position tracking within a given sequence, using regular expressions effectively. Examples provided for better understanding.

1 / 21

Download Presentation
Télécharger la présentation

Finding substrings

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Finding substrings my $sequence = "gatgcaggctcgctagcggct"; #Does this string contain a startcodon? if ($sequence =~ m/atg/) { print "Yes"; } else { print "No"; }

  2. Finding substrings my $sequence = "gatgcaggctcgctagcggct"; #Does this string contain a startcodon? if ($sequence =~ m/atg/) { print "Yes"; } else { print "No"; } =~ is a binding operator and means: perform the following action on this variable. The following action m/atg/ in this case is a substring search, with the "m" for "match"' and substring "atg".

  3. Finding substrings my $sequence = "gatgcaggctcgctagcggct"; #Does this string contain a startcodon? if ($sequence =~ m/atg/) { print "Yes"; } else { print "No"; } If the substring occurs, the statement will return TRUE and the if-block will be executed. The value of $sequence does not change by the match.

  4. Finding substrings, repeated my $sequence = "gatgcaggctcgctagcggct"; my $count = 0; while($sequence =~ m/ggc/g) { $count++; } print "$count matches for gcc\n";

  5. m//g 'g' option allows repeated matching, because the position of the last match is remembered

  6. Finding substrings, repeated my $sequence = "gatgcaggctcgctagcggct"; my $count = 0; while($sequence =~ m/ggc/g) { $count++; } print "$count matches for gcc\n";

  7. Finding substrings, repeated my $sequence = "gatgcaggctcgctagcggct"; my $codon = "ggc"; my $count = 0; while($sequence =~ m/$codon/g) { $count++; } print "$count matches for $codon\n";

  8. Position after last match my $sequence = "gatgcaggctcgctagcggct"; my $codon = "ggc"; print "looking for $codon from 0\n"; while($sequence =~ m/$codon/g) { print "found, will continue from: "; print pos($sequence),"\n"; }

  9. Position after last match my $sequence = "gatgcaggctcgctagcggct"; my $codon = "ggc"; pos($sequence) = 10; print "looking for $codon from 10\n"; while($sequence =~ m/$codon/g) { print "found, will continue from: "; print pos($sequence),"\n"; }

  10. Replacing substrings my $sequence = "gatgcagaattcgctagcggct"; print $sequence,"\n"; #Replace the EcoRI site with '******' $sequence =~ s/gaattc/******/; # gatgca******gctagcggct #Replace all the other characters with space $sequence =~ s/[^*]/ /g; print $sequence,"\n"; Output: gatgcagaattcgctagcggct ******

  11. Examples of regular expressions s/World/Wur/ replaces World with Wur, making "Hello World" "Hello Wur" s/t/u/ replaces the first 't' with 'u', "atgtag" becomes "augtag" s/t/u/g replaces all 't's with 'u's, "atgtag" becomes "auguag" s/[gatc]/N/g replaces all g,a,t,c's with N, "atgtag" becomes "NNNNNN" s/[^gatc]//g replaces all characters that are not g,a,t or c with nothing s/a{3}/NNN/g replaces all 'aaa' with 'NNN', "taaataa" becomes "tNNNtaa" m/sq/i match 'sq', 'Sq', 'sQ' and SQ: case insensitive m/^SQ/ match 'SQ' at the beginning of the string m/^[^S]/ match strings that do not begin with 'S' m/att?g/ match 'attg' and 'atg' m/a.g/ match 'atg', 'acg', 'aag', 'agg', 'a g', 'aHg' etc. s/(\w+) (\w+)/$2 $1/ swap two words, "one two" => "two one" m/atg(…)*?(ta[ag]|tga)/ matches an ORF

  12. The matched strings are stored my $text = "This is a piece of text\n"; print $text; $word = 0; while($text =~ /(\w+)\W/g) { $word++; print "word $word: $1\n"; }

  13. The matched strings are stored my $text = "one two"; $text =~ /(\w+) (\w+)/g print "word one:$1 "; print "word two:$2 "; print "complete string: $&";

  14. The matched strings are stored my $sequence = "gatgcaggctcgctagcggct"; while ($sequence =~ m/([acgt]{3})/g) { print "$1\n"; }

  15. Special characters \t tab \n newline \r return (CR) \b "word" boundary \B not a "word" boundary \w matches any single character classified as a "word" character (alphanumeric or _) \W matches any non-"word" character \s matches any whitespace character (space, tab, newline) \S matches any non-whitespace character \d matches any digit character, equiv. to [0-9] \D matches any non-digit character \xhh character with hex. code hh

  16. Metacharacters ^ beginning of string $ end of string . any character except newline * match 0 or more times + match 1 or more times ? match 0 or 1 times; or shortest match | alternative ( ) grouping, or storing [ ] set of characters { } repetition modifier \ quote or special

  17. Repetition a* zero or more a's a+ one or more a's a? zero or one a's (i.e., optional a) a{m} exactly m a's a{m,} at least m a's a{m,n} at least m but at most n a's a{0,n} at most n a's $mRNAsequence = "aaaauaaaaa"; $mRNAsequence =~ m/a{2,}ua{3,}/;

  18. Greediness Pattern matching in Perl by default is greedy, which means that it will try to match as much characters as possible. This can be prevented by appending the ? Operator to the expression $sequence = "atgtagtagtagtagtag"; #This will replace the entire string: s/atg(tag)*// #This will stop matching at the first tag: s/atg(tag)*?//

  19. open SEQFILE, "example1.fasta"; my $sequence = ""; my $ID = <SEQFILE>; while (<SEQFILE>) { chomp; $sequence .= $_; } print $ID; print $sequence,"\n"; #SmaI striction (ccc^ggg) $sequence =~ s/cccggg/ccc^ggg/g; #PvuII striction (cag^ctg) $sequence =~ s/cagctg/cag^ctg/g; my @sequenceFragments = split '\^', $sequence; print "\n", "-"x90, "\n"; print "Digested sequence:\n",$sequence,"\n\n"; print "-"x90,"\n"; print "Fragments:\n"; foreach $fragment(@sequenceFragments) { print $fragment,"\n"; print "-"x90,"\n"; }

  20. >BTBSCRYR Bovine mRNA for lens beta-s-crystallin... tgcaccaaacatgtctaaagctggaaccaaaattactttctttgaagacaaaaactttcaaggccgccactatgacagcgattgcgactgtgcagatttccacatgtacctgagccgctgcaactccatcagagtggaaggaggcacctgggctgtgtatgaaaggcccaattttgctgggtacatgtacatcctaccccggggcgagtatcctgagtaccagcactggatgggcctcaacgaccgcctcagctcctgcagggctgttcacctgtctagtggaggccagtataagcttcagatctttgagaaaggggattttaatggtcagatgcatgagaccacggaagactgcccttccatcatggagcagttccacatgcgggaggtccactcctgtaaggtgctggagggcgcctggatcttctatgagctgcccaactaccgaggcaggcagtacctgctggacaagaaggagtaccggaagcccgtcgactggggtgcagcttccccagctgtccagtctttccgccgcattgtggagtgatgatacagatgcggccaaacgctggctggccttgtcatccaaataagcattataaataaaacaattggcatgc ------------------------------------------------------------------------------------------ Digested sequence: tgcaccaaacatgtctaaagctggaaccaaaattactttctttgaagacaaaaactttcaaggccgccactatgacagcgattgcgactgtgcagatttccacatgtacctgagccgctgcaactccatcagagtggaaggaggcacctgggctgtgtatgaaaggcccaattttgctgggtacatgtacatcctacccc^ggggcgagtatcctgagtaccagcactggatgggcctcaacgaccgcctcagctcctgcagggctgttcacctgtctagtggaggccagtataagcttcagatctttgagaaaggggattttaatggtcagatgcatgagaccacggaagactgcccttccatcatggagcagttccacatgcgggaggtccactcctgtaaggtgctggagggcgcctggatcttctatgagctgcccaactaccgaggcaggcagtacctgctggacaagaaggagtaccggaagcccgtcgactggggtgcagcttccccag^ctgtccagtctttccgccgcattgtggagtgatgatacagatgcggccaaacgctggctggccttgtcatccaaataagcattataaataaaacaattggcatgc ------------------------------------------------------------------------------------------ Fragments: tgcaccaaacatgtctaaagctggaaccaaaattactttctttgaagacaaaaactttcaaggccgccactatgacagcgattgcgactgtgcagatttccacatgtacctgagccgctgcaactccatcagagtggaaggaggcacctgggctgtgtatgaaaggcccaattttgctgggtacatgtacatcctacccc ------------------------------------------------------------------------------------------ ggggcgagtatcctgagtaccagcactggatgggcctcaacgaccgcctcagctcctgcagggctgttcacctgtctagtggaggccagtataagcttcagatctttgagaaaggggattttaatggtcagatgcatgagaccacggaagactgcccttccatcatggagcagttccacatgcgggaggtccactcctgtaaggtgctggagggcgcctggatcttctatgagctgcccaactaccgaggcaggcagtacctgctggacaagaaggagtaccggaagcccgtcgactggggtgcagcttccccag ------------------------------------------------------------------------------------------ ctgtccagtctttccgccgcattgtggagtgatgatacagatgcggccaaacgctggctggccttgtcatccaaataagcattataaataaaacaattggcatgc ------------------------------------------------------------------------------------------

  21. Exercises • Create a script to find the DNA fragments you get after cutting the sequence in the example1.fasta file with AluI and with AvaI • Find the open reading frames in the example1.fasta sequence • Translate the open reading frames to protein, using the standard genetic code from the Geneticcode database (http://srs.bioinformatics.nl)

More Related
SlideServe
Audio
Live Player
Audio Wave
Play slide audio to activate visualizer