Finding substrings

1. Finding substrings my $sequence = "gatgcaggctcgctagcggct"; #Does this string contain a startcodon? if ($sequence =~ m/atg/) { print "Yes"; } else { print "No"; }

2. Finding substrings my $sequence = "gatgcaggctcgctagcggct"; #Does this string contain a startcodon? if ($sequence =~ m/atg/) { print "Yes"; } else { print "No"; } =~ is a binding operator and means: perform the following action on this variable. The following action m/atg/ in this case is a substring search, with the "m" for "match"' and substring "atg".

3. Finding substrings my $sequence = "gatgcaggctcgctagcggct"; #Does this string contain a startcodon? if ($sequence =~ m/atg/) { print "Yes"; } else { print "No"; } If the substring occurs, the statement will return TRUE and the if-block will be executed. The value of $sequence does not change by the match.

4. Finding substrings, repeated my $sequence = "gatgcaggctcgctagcggct"; my $count = 0; while($sequence =~ m/ggc/g) { $count++; } print "$count matches for gcc\n";

5. m//g 'g' option allows repeated matching, because the position of the last match is remembered

6. Finding substrings, repeated my $sequence = "gatgcaggctcgctagcggct"; my $count = 0; while($sequence =~ m/ggc/g) { $count++; } print "$count matches for gcc\n";

7. Finding substrings, repeated my $sequence = "gatgcaggctcgctagcggct"; my $codon = "ggc"; my $count = 0; while($sequence =~ m/$codon/g) { $count++; } print "$count matches for $codon\n";

8. Position after last match my $sequence = "gatgcaggctcgctagcggct"; my $codon = "ggc"; print "looking for $codon from 0\n"; while($sequence =~ m/$codon/g) { print "found, will continue from: "; print pos($sequence),"\n"; }

9. Position after last match my $sequence = "gatgcaggctcgctagcggct"; my $codon = "ggc"; pos($sequence) = 10; print "looking for $codon from 10\n"; while($sequence =~ m/$codon/g) { print "found, will continue from: "; print pos($sequence),"\n"; }

10. Replacing substrings my $sequence = "gatgcagaattcgctagcggct"; print $sequence,"\n"; #Replace the EcoRI site with '******' $sequence =~ s/gaattc/******/; # gatgca******gctagcggct #Replace all the other characters with space $sequence =~ s/[^*]/ /g; print $sequence,"\n"; Output: gatgcagaattcgctagcggct ******

11. Examples of regular expressions s/World/Wur/ replaces World with Wur, making "Hello World" "Hello Wur" s/t/u/ replaces the first 't' with 'u', "atgtag" becomes "augtag" s/t/u/g replaces all 't's with 'u's, "atgtag" becomes "auguag" s/[gatc]/N/g replaces all g,a,t,c's with N, "atgtag" becomes "NNNNNN" s/[^gatc]//g replaces all characters that are not g,a,t or c with nothing s/a{3}/NNN/g replaces all 'aaa' with 'NNN', "taaataa" becomes "tNNNtaa" m/sq/i match 'sq', 'Sq', 'sQ' and SQ: case insensitive m/^SQ/ match 'SQ' at the beginning of the string m/^[^S]/ match strings that do not begin with 'S' m/att?g/ match 'attg' and 'atg' m/a.g/ match 'atg', 'acg', 'aag', 'agg', 'a g', 'aHg' etc. s/(\w+) (\w+)/$2 $1/ swap two words, "one two" => "two one" m/atg(…)*?(ta[ag]|tga)/ matches an ORF

12. The matched strings are stored my $text = "This is a piece of text\n"; print $text; $word = 0; while($text =~ /(\w+)\W/g) { $word++; print "word $word: $1\n"; }

13. The matched strings are stored my $text = "one two"; $text =~ /(\w+) (\w+)/g print "word one:$1 "; print "word two:$2 "; print "complete string: $&";

14. The matched strings are stored my $sequence = "gatgcaggctcgctagcggct"; while ($sequence =~ m/([acgt]{3})/g) { print "$1\n"; }

15. Special characters \t tab \n newline \r return (CR) \b "word" boundary \B not a "word" boundary \w matches any single character classified as a "word" character (alphanumeric or _) \W matches any non-"word" character \s matches any whitespace character (space, tab, newline) \S matches any non-whitespace character \d matches any digit character, equiv. to [0-9] \D matches any non-digit character \xhh character with hex. code hh

16. Metacharacters ^ beginning of string $ end of string . any character except newline * match 0 or more times + match 1 or more times ? match 0 or 1 times; or shortest match | alternative ( ) grouping, or storing [ ] set of characters { } repetition modifier \ quote or special

17. Repetition a* zero or more a's a+ one or more a's a? zero or one a's (i.e., optional a) a{m} exactly m a's a{m,} at least m a's a{m,n} at least m but at most n a's a{0,n} at most n a's $mRNAsequence = "aaaauaaaaa"; $mRNAsequence =~ m/a{2,}ua{3,}/;

18. Greediness Pattern matching in Perl by default is greedy, which means that it will try to match as much characters as possible. This can be prevented by appending the ? Operator to the expression $sequence = "atgtagtagtagtagtag"; #This will replace the entire string: s/atg(tag)*// #This will stop matching at the first tag: s/atg(tag)*?//

19. open SEQFILE, "example1.fasta"; my $sequence = ""; my $ID = <SEQFILE>; while (<SEQFILE>) { chomp; $sequence .= $_; } print $ID; print $sequence,"\n"; #SmaI striction (ccc^ggg) $sequence =~ s/cccggg/ccc^ggg/g; #PvuII striction (cag^ctg) $sequence =~ s/cagctg/cag^ctg/g; my @sequenceFragments = split '\^', $sequence; print "\n", "-"x90, "\n"; print "Digested sequence:\n",$sequence,"\n\n"; print "-"x90,"\n"; print "Fragments:\n"; foreach $fragment(@sequenceFragments) { print $fragment,"\n"; print "-"x90,"\n"; }

20. >BTBSCRYR Bovine mRNA for lens beta-s-crystallin... tgcaccaaacatgtctaaagctggaaccaaaattactttctttgaagacaaaaactttcaaggccgccactatgacagcgattgcgactgtgcagatttccacatgtacctgagccgctgcaactccatcagagtggaaggaggcacctgggctgtgtatgaaaggcccaattttgctgggtacatgtacatcctaccccggggcgagtatcctgagtaccagcactggatgggcctcaacgaccgcctcagctcctgcagggctgttcacctgtctagtggaggccagtataagcttcagatctttgagaaaggggattttaatggtcagatgcatgagaccacggaagactgcccttccatcatggagcagttccacatgcgggaggtccactcctgtaaggtgctggagggcgcctggatcttctatgagctgcccaactaccgaggcaggcagtacctgctggacaagaaggagtaccggaagcccgtcgactggggtgcagcttccccagctgtccagtctttccgccgcattgtggagtgatgatacagatgcggccaaacgctggctggccttgtcatccaaataagcattataaataaaacaattggcatgc ------------------------------------------------------------------------------------------ Digested sequence: tgcaccaaacatgtctaaagctggaaccaaaattactttctttgaagacaaaaactttcaaggccgccactatgacagcgattgcgactgtgcagatttccacatgtacctgagccgctgcaactccatcagagtggaaggaggcacctgggctgtgtatgaaaggcccaattttgctgggtacatgtacatcctacccc^ggggcgagtatcctgagtaccagcactggatgggcctcaacgaccgcctcagctcctgcagggctgttcacctgtctagtggaggccagtataagcttcagatctttgagaaaggggattttaatggtcagatgcatgagaccacggaagactgcccttccatcatggagcagttccacatgcgggaggtccactcctgtaaggtgctggagggcgcctggatcttctatgagctgcccaactaccgaggcaggcagtacctgctggacaagaaggagtaccggaagcccgtcgactggggtgcagcttccccag^ctgtccagtctttccgccgcattgtggagtgatgatacagatgcggccaaacgctggctggccttgtcatccaaataagcattataaataaaacaattggcatgc ------------------------------------------------------------------------------------------ Fragments: tgcaccaaacatgtctaaagctggaaccaaaattactttctttgaagacaaaaactttcaaggccgccactatgacagcgattgcgactgtgcagatttccacatgtacctgagccgctgcaactccatcagagtggaaggaggcacctgggctgtgtatgaaaggcccaattttgctgggtacatgtacatcctacccc ------------------------------------------------------------------------------------------ ggggcgagtatcctgagtaccagcactggatgggcctcaacgaccgcctcagctcctgcagggctgttcacctgtctagtggaggccagtataagcttcagatctttgagaaaggggattttaatggtcagatgcatgagaccacggaagactgcccttccatcatggagcagttccacatgcgggaggtccactcctgtaaggtgctggagggcgcctggatcttctatgagctgcccaactaccgaggcaggcagtacctgctggacaagaaggagtaccggaagcccgtcgactggggtgcagcttccccag ------------------------------------------------------------------------------------------ ctgtccagtctttccgccgcattgtggagtgatgatacagatgcggccaaacgctggctggccttgtcatccaaataagcattataaataaaacaattggcatgc ------------------------------------------------------------------------------------------

21. Exercises • Create a script to find the DNA fragments you get after cutting the sequence in the example1.fasta file with AluI and with AvaI • Find the open reading frames in the example1.fasta sequence • Translate the open reading frames to protein, using the standard genetic code from the Geneticcode database (http://srs.bioinformatics.nl)