1 / 29

Use of tethering for axial confinement in optical tweezers

Use of tethering for axial confinement in optical tweezers. Mark Cronin-Golomb Biomedical Engineering Tufts University. Outline. Motivation Design of l DNA tether Videos of untethered and tethered particles Confocal detection measurement system Demonstration of force measurement

brooklyn
Télécharger la présentation

Use of tethering for axial confinement in optical tweezers

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Use of tethering for axial confinement in optical tweezers Mark Cronin-Golomb Biomedical Engineering Tufts University

  2. Outline • Motivation • Design of l DNA tether • Videos of untethered and tethered particles • Confocal detection measurement system • Demonstration of force measurement • Future directions

  3. Tethers and tweezers • Microspheres tethered to each other (Chu) • Backscattering from tethered bead as probe of DNA flexibility (Libchaber APL 73, 291 (1998)) • Twisting polymers by applying torque to trapped particle (Bustamante Nature 424, 338 (2003), Ormos) • Study of macromolecular motion (Gelles)

  4. Use of low numerical aperture trapping lenses • Trapping particles against glass slide • Trapping against counterflow • Trapping against gravity

  5. Axial trapping is harder to achieve than transverse trapping • Generalized Lorenz-Mie theory to find radiation pressure cross section Cpr(z) and radiation pressure forceFin terms of standard Mie scattering coefficients: K.F. Ren, G. Gréhan, and G. Gouesbet, Appl. Opt. 35, 2702 (1996)

  6. Axial force with 1.25NA beam 1mm diameter polystyrene bead, 13mW 820nm wavelength trap

  7. Axial force for 0.65NA beam

  8. Beads in 0.65NA trap without tether

  9. Bead Bead NA 1.3 Trap Beam Trap Beam Comparison of original and tethered configurations lDNA 48k base pairs 31.5x106 Dalton

  10. Experiment Details

  11. No dCTP stop C C C A C G G G G G U G GGGCGGCGACCTCGCGGGTT AGGTTACG | | | | | | | | | | | | | | | | | | | | | | | | |||||||| |||||||| G C A U C C C G G C C G GCGCCCAA TCCAATGCCCCGCCGCTGGA DIG | No dCTP stop | biotin End labeling l DNA for attachment to streptavidin and anti-digoxigenin 1. dNTPs – dCTP + biotin-dUTP + Klenow 2. + dCTP + digoxigenin-dUTP Zimmermann and Cox, Nucleic Acids Research 22, 492 (1994)

  12. Goat anti-mouse IgG bead Mouse anti-DIG antibody DIG Biotin Streptavidin Cover slip Tether construct Modified from Meiners and Quake Phys. Rev. Lett. 84, 5014 (2000)

  13. Frame sequence from tethered bead video 10 mm

  14. 10mm Tethered beads in 0.65NA trap Tracking Software implemented in IDL by Crocker and Weeks http://www.physics.emory.edu/~weeks/idl/

  15. Experiment Details: measurements

  16. As the tweezer beam is moved back and forth, the probe bead lags behind. • The bead is bright when the tweezer beam illuminates it. • The confocal signal is highest when the tweezer beam is centered on the probe bead.

  17. At large oscillation amplitudes the potential well splits

  18. Theoretical Background x: trap positiong: viscous drag k: tweezer spring constant a: amplitude of trap oscillation w: frequency of trap oscillation L(t): Brownian forcing function

  19. Viscosity Image • Viscosity distribution around A. pullulans imaged by raster scanning an optically trapped probe bead. • This blastospore has a halo of the polysaccharide pullulan around it. Note the viscosity gradient.

  20. Force Off Force On Probe Bead Probe Bead r a a OscillatingLaser Trap OscillatingLaser Trap

  21. Force Measurement • We can use confocal tweezers to measure forces applied to probe beads. • Flow measurement is one example of force measurement

  22. Force measurement • An optically trapped microsphere is used as a probe for two-dimensional force imaging using scanning optics. • A fluid viscosity map may be obtained simultaneously. • Calibration is based on a single length measurement only: the oscillation amplitude a of the trap.

  23. Transverse force on tethered bead

  24. Detector and electronics Laser in Piezotransducer Further applications • Fiber based sensor

  25. Applications • Photonic force microscope with retained probe bead • Measurement of changes in tether properties with environment, e.g. with enzymes, buffer properties etc.

  26. Array of tethered beads for actin network network generation and analysis Actin From Christian Schmitz’ talk

  27. Conclusions • Probe beads can be tethered to substrates to eliminate need for axial trapping, enabling use of low NA objectives. • Measurements of viscosity and force can be made with tethered beads via confocal detection system • References to confocal detection method: • Nemet, Shabtai, Cronin-Golomb, Opt. Lett. 27, 264 (2002) • Nemet, Cronin-Golomb, Opt. Lett. 27, 1357, (2002) • Nemet, Cronin-Golomb, Appl. Opt. 42, 1820 (2003)

  28. Acknowledgements • Boaz Nemet • Joe Platko • Support of Tufts University Bioengineering Center

More Related