DNA & Protein Synthesis
DNA & Protein Synthesis. Gene to Protein. Nucleic Acids and Protein Synthesis. All functions of a cell are directed from some central form of information. This "biological program" is called the Genetic Code . - The way cell store information regarding it's structure and function. History.
DNA & Protein Synthesis
E N D
Presentation Transcript
DNA & Protein Synthesis Gene to Protein
Nucleic Acids and Protein Synthesis • All functions of a cell are directed from some central form of information. • This "biological program" is called the Genetic Code. - The way cell store information regarding it's structure and function.
History • For years the source of heredity was unknown. This was resolved after numerous studies and experimental research by the following researchers: • Fredrick Griffith • He was studying effects of 2 strains of an infectious bacteria, the "smooth" strain was found to cause pneumonia & death in mice. The "rough" strain did not. He conducted the following experiment
Griffith Experiment • The last condition was unusual, as he predicted that the mouse should live • Concluded that some unknown substance was Transforming the rough strain into the smooth one
Avery, McCarty & MacLeod • Tried to determine the nature of this transforming agent. Eg. Was it protein or DNA? • Degraded chromosomes with enzymes which destroyed proteins or DNA • Samples with Proteins destroyed would still cause transformation in bacteria indicating genetic material was DNA
Hershey-Chase • 1 virus was "tagged" with 32P on it's DNA • The other was "tagged" 35S on it's protein coat. • Researchers found the radioactive P in the bacteria, indicating it is DNA, not protein being injected into bacteria.
Watson & Crick • The constituents of DNA had long been known. Structure of DNA, however was not. • In 1953, Watson & Crick published findings based on X-ray analysis and other data that DNA was in the form of a "Double Helix". • Their findings show us the basic structure of DNA which is as follows.
DNA Structure • DNA is Formed of in a "Double Helix" - like a spiral staircase
Nucleotides • DNA is formed by Nucleotides • These are made from 3 components • A 5-Carbon Sugar • A Nitrogenous base • A Phosphate group
Nucleotide types: • For DNA There are 4 different Nucleotides categorized as either Purines or Pyramidines. These are usually represented by a letter. These Are: • Adenine (A) • Cytosine (C) • Guanine (G) • Thymine (T)
Base Pairing • Each "Rung" of the DNA "staircase" is formed by the linking of 2 Nucleotides through Hydrogen Bonds. • These Hydrogen bonds form only between specific Nucleotides. This is known as Base Pairing. The rules are as follows: • Adenine (A) will ONLY bond to Thymine (T) (by 2 hydrogen bonds) • Cytosine (C) will ONLY bond to Guanine (G) (by 3 hydrogen bonds)
Central dogma of genetics • Central Dogma holds that genetic information is expressed in a specific order. This order is as follows There are some apparent exceptions to this. Retroviruses (eg. HIV) are able to synthesize DNA from RNA
DNA Replication • DNA has unique ability to make copies of itself • This is a major "driving force" of living things. • Does so through the process of DNA Replication. • Complex process • DNA "Unzips itself" forming two strands with an exposed Nucleotide. • An nucleotide which forms the appropriate Base-pair bonds with the exposed nucleotide. This is facilitated by the enzyme DNA Polymerase. • The process moves down the DNA molecule, and once complete, results in two identical DNA strands. • Transcription proceeds continuously along the 5'3' direction (This is called the leading strand) • Proceeds in fragments in the other direction (called the lagging strand) in the following way • RNA primer attached to a segment of the strand by enzyme primase. • Transcription now continues in the 5'3' direction forming an okazakifragment. Until it reaches the next fragment. • The two fragments are joined by DNA ligase
RNA Transcription • The cell does not directly use DNA to control the function of the cell. • DNA is too precious and must be kept protected within the nucleus. • The Cell makes a working "Photocopy" of itself to do the actual work of making proteins. • This copy is called Ribonucleic Acid or RNA. • RNA differs from DNA in several important ways. • It is much smaller • It is single-stranded • It does NOT contain Thymine, but rather a new nucleotide called Uracil which will bind to Adenine.
RNA Transcription • RNA is produced through a process called RNA Transcription. • Similar to DNA Replication. • Small area of DNA "Unzips" exposing Nucleotides • This area is acted on by an enzyme called RNA Polymerase, which binds nucleotides (using uracil) to their complimentary base pair. • This releases a long strand of Messenger RNA (mRNA) which is an important component ofprotein synthesis.
Protein Synthesis & The Genetic Code • The Sequence of nucleotides in an mRNA strand determine the sequence of amino acids in a protein • Process requires mRNA, tRNA & ribosomes
mRNA • Each three Nucleotide sequence in an mRNA strand is called a "Codon" Each Codon codes for a particular amino acid. • The codon sequence codes for an amino acid using specific rules. These specific codon/amino acid pairings is called the Genetic Code.
tRNA • There is a special form of RNA called Transfer RNA or tRNA. • Each tRNA has a 3 Nucleotide sequence on one end which is known as the "Anitcodon" • This Anticodon sequence is complimentary to the Codon sequence found on the strand of mRNA • Each tRNA can bind specifically with a particular amino acid.
Ribosome • Consists of two subunits • Large subunit • Small subunit • Serves as a template or "work station" where protein synthesis can occur.
Protein Synthesis • Protein synthesis is a complex, many step process, it is as follows. • An mRNA strand binds to the large & small subunits of a ribosome in the cytoplasm of the cell • This occurs at the AUG (initiation) codon of the strand. • A tRNA molecule with an attached amino acid binds to the mRNA strand. • Note: This occurs with complimentary codons & anti-codons. • Another tRNA binds to the adjacent codon of the mRNA • A peptide bond is formed between the amino acids • The first tRNA is released, and another tRNA binds next to the second, another peptide bond is formed. • This process continues until a stop codon is reached. • The completed polypeptide is then released.
Replication Problem • Given a DNA strand with the following nucleotide sequence, what is the sequence of its complimentary strand? • 3’- TACCACGTGGACTGAGGACTCCTCTTCAGA -5’
Answer • Given a DNA strand with the following nucleotide sequence, what is the sequence of its complimentary strand? • 3’- TACCACGTGGACTGAGGACTCCTCTTCAGA -5’ • 5’- ATGGTGCACCTGACTCCTGAGGAGAAGTCT -3’
RNA Transcription Problem • Given a DNA strand with the following nucleotide sequence, what is the sequence of its complimentary mRNA strand? • 3’- TACCACGTGGACTGAGGACTCCTCTTCAGA -5’
ANSWER • Given a DNA strand with the following nucleotide sequence, what is the sequence of its complimentary mRNA strand? • 3’- TACCACGTGGACTGAGGACTCCTCTTCAGA -5’ • 3’- AUGGUGCACCUGACUCCUGAGGAGAAGUCU -5’
Codon / Anticodon • Given a mRNa strand with the following nucleotide sequence, what are the sequence (anticodons) of its complimentary tRNA strands? • 3’- AUGGUGCACCUGACUCCUGAGGAGAAGUCU -5’
Answer Given a mRNA strand with the following nucleotide sequence, what are the sequence (anticodons) of its complimentary tRNA strands? 3’- AUGGUGCACCUGACUCCUGAGGAGAAGUCU -5’
Protein Translation • Given the following sequence of mRNA, what is the amino acid sequence of the resultant polypeptide? • AUGGUGCACCUGACUCCUGAGGAGAAGUCU
Protein Translation / Answer • Given the following sequence of mRNA, what is the amino acid sequence of the resultant polypeptide? • AUGGUGCACCUGACUCCUGAGGAGAAGUCU Met-val-his-leu-thr-pro-glu-glu-lys-ser