cara
Uploaded by
29 SLIDES
501 VUES
300LIKES

DNA & Protein Synthesis

DESCRIPTION

DNA & Protein Synthesis. Gene to Protein. Nucleic Acids and Protein Synthesis. All functions of a cell are directed from some central form of information. This "biological program" is called the Genetic Code . - The way cell store information regarding it's structure and function. History.

1 / 29

Télécharger la présentation

DNA & Protein Synthesis

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. DNA & Protein Synthesis Gene to Protein

  2. Nucleic Acids and Protein Synthesis • All functions of a cell are directed from some central form of information. • This "biological program" is called the Genetic Code. - The way cell store information regarding it's structure and function.

  3. History • For years the source of heredity was unknown. This was resolved after numerous studies and experimental research by the following researchers: • Fredrick Griffith • He was studying effects of 2 strains of an infectious bacteria, the "smooth" strain was found to cause pneumonia & death in mice. The "rough" strain did not. He conducted the following experiment

  4. Griffith Experiment • The last condition was unusual, as he predicted that the mouse should live • Concluded that some unknown substance was Transforming the rough strain into the smooth one

  5. Avery, McCarty & MacLeod • Tried to determine the nature of this transforming agent. Eg. Was it protein or DNA? • Degraded chromosomes with enzymes which destroyed proteins or DNA • Samples with Proteins destroyed would still cause transformation in bacteria indicating genetic material was DNA

  6. Hershey-Chase • 1 virus was "tagged" with 32P on it's DNA • The other was "tagged" 35S on it's protein coat. • Researchers found the radioactive P in the bacteria, indicating it is DNA, not protein being injected into bacteria.

  7. Watson & Crick • The constituents of DNA had long been known. Structure of DNA, however was not. • In 1953, Watson & Crick published findings based on X-ray analysis and other data that DNA was in the form of a "Double Helix". • Their findings show us the basic structure of DNA which is as follows.

  8. DNA Structure • DNA is Formed of in a "Double Helix" - like a spiral staircase

  9. Nucleotides • DNA is formed by Nucleotides • These are made from 3 components • A 5-Carbon Sugar • A Nitrogenous base • A Phosphate group

  10. Nucleotide types: • For DNA There are 4 different Nucleotides categorized as either Purines or Pyramidines. These are usually represented by a letter. These Are: • Adenine (A) • Cytosine (C) • Guanine (G) • Thymine (T)

  11. Base Pairing • Each "Rung" of the DNA "staircase" is formed by the linking of 2 Nucleotides through Hydrogen Bonds. • These Hydrogen bonds form only between specific Nucleotides. This is known as Base Pairing. The rules are as follows: • Adenine (A) will ONLY bond to Thymine (T) (by 2 hydrogen bonds) • Cytosine (C) will ONLY bond to Guanine (G) (by 3 hydrogen bonds)

  12. Central dogma of genetics • Central Dogma holds that genetic information is expressed in a specific order. This order is as follows There are some apparent exceptions to this. Retroviruses (eg. HIV) are able to synthesize DNA from RNA

  13. DNA Replication • DNA has unique ability to make copies of itself • This is a major "driving force" of living things. • Does so through the process of DNA Replication. • Complex process • DNA "Unzips itself" forming two strands with an exposed Nucleotide. • An nucleotide which forms the appropriate Base-pair bonds with the exposed nucleotide. This is facilitated by the enzyme DNA Polymerase. • The process moves down the DNA molecule, and once complete, results in two identical DNA strands. • Transcription proceeds continuously along the 5'3' direction (This is called the leading strand) • Proceeds in fragments in the other direction (called the lagging strand) in the following way • RNA primer attached to a segment of the strand by enzyme primase. • Transcription now continues in the 5'3' direction forming an okazakifragment. Until it reaches the next fragment. • The two fragments are joined by DNA ligase

  14. DNA Replication

  15. RNA Transcription • The cell does not directly use DNA to control the function of the cell. • DNA is too precious and must be kept protected within the nucleus. • The Cell makes a working "Photocopy" of itself to do the actual work of making proteins. • This copy is called Ribonucleic Acid or RNA. • RNA differs from DNA in several important ways. • It is much smaller • It is single-stranded • It does NOT contain Thymine, but rather a new nucleotide called Uracil which will bind to Adenine.

  16. RNA Transcription • RNA is produced through a process called RNA Transcription. • Similar to DNA Replication. • Small area of DNA "Unzips" exposing Nucleotides • This area is acted on by an enzyme called RNA Polymerase, which binds nucleotides (using uracil) to their complimentary base pair. • This releases a long strand of Messenger RNA (mRNA) which is an important component ofprotein synthesis.

  17. Protein Synthesis & The Genetic Code • The Sequence of nucleotides in an mRNA strand determine the sequence of amino acids in a protein • Process requires mRNA, tRNA & ribosomes

  18. mRNA • Each three Nucleotide sequence in an mRNA strand is called a "Codon" Each Codon codes for a particular amino acid. • The codon sequence codes for an amino acid using specific rules. These specific codon/amino acid pairings is called the Genetic Code.

  19. tRNA • There is a special form of RNA called Transfer RNA or tRNA. • Each tRNA has a 3 Nucleotide sequence on one end which is known as the "Anitcodon" • This Anticodon sequence is complimentary to the Codon sequence found on the strand of mRNA • Each tRNA can bind specifically with a particular amino acid.

  20. Ribosome • Consists of two subunits • Large subunit • Small subunit • Serves as a template or "work station" where protein synthesis can occur.

  21. Protein Synthesis • Protein synthesis is a complex, many step process, it is as follows. • An mRNA strand binds to the large & small subunits of a ribosome in the cytoplasm of the cell • This occurs at the AUG (initiation) codon of the strand. • A tRNA molecule with an attached amino acid binds to the mRNA strand. • Note: This occurs with complimentary codons & anti-codons. • Another tRNA binds to the adjacent codon of the mRNA • A peptide bond is formed between the amino acids • The first tRNA is released, and another tRNA binds next to the second, another peptide bond is formed. • This process continues until a stop codon is reached. • The completed polypeptide is then released.

  22. Replication Problem • Given a DNA strand with the following nucleotide sequence, what is the sequence of its complimentary strand? • 3’- TACCACGTGGACTGAGGACTCCTCTTCAGA -5’

  23. Answer • Given a DNA strand with the following nucleotide sequence, what is the sequence of its complimentary strand? • 3’- TACCACGTGGACTGAGGACTCCTCTTCAGA -5’ • 5’- ATGGTGCACCTGACTCCTGAGGAGAAGTCT -3’

  24. RNA Transcription Problem • Given a DNA strand with the following nucleotide sequence, what is the sequence of its complimentary mRNA strand? • 3’- TACCACGTGGACTGAGGACTCCTCTTCAGA -5’

  25. ANSWER • Given a DNA strand with the following nucleotide sequence, what is the sequence of its complimentary mRNA strand? • 3’- TACCACGTGGACTGAGGACTCCTCTTCAGA -5’ • 3’- AUGGUGCACCUGACUCCUGAGGAGAAGUCU -5’

  26. Codon / Anticodon • Given a mRNa strand with the following nucleotide sequence, what are the sequence (anticodons) of its complimentary tRNA strands? • 3’- AUGGUGCACCUGACUCCUGAGGAGAAGUCU -5’

  27. Answer Given a mRNA strand with the following nucleotide sequence, what are the sequence (anticodons) of its complimentary tRNA strands? 3’- AUGGUGCACCUGACUCCUGAGGAGAAGUCU -5’

  28. Protein Translation • Given the following sequence of mRNA, what is the amino acid sequence of the resultant polypeptide? • AUGGUGCACCUGACUCCUGAGGAGAAGUCU

  29. Protein Translation / Answer • Given the following sequence of mRNA, what is the amino acid sequence of the resultant polypeptide? • AUGGUGCACCUGACUCCUGAGGAGAAGUCU Met-val-his-leu-thr-pro-glu-glu-lys-ser

More Related
SlideServe
Audio
Live Player
Audio Wave
Play slide audio to activate visualizer