From Gene to Protein: Understanding Genetics and Protein Synthesis
Learn about the journey from genes to proteins using examples such as alkaptonuria and PKU. Explore the Central Dogma, transcription, translation, and the complexities of defining a gene. Discover how genetic information is processed in cells. Let’s study genetics and protein synthesis together!
From Gene to Protein: Understanding Genetics and Protein Synthesis
E N D
Presentation Transcript
From Gene to Protein Chapter 17
Bell Work AUG – UUA – CAU – AAC – AUA – AAU – CUG – GGG – UGA Get out the CH. 17 notes packet Can you transcribe the following DNA? TAC – AAT – GTA – TTG – TAT – TTA – GAC – CCC - ACT
A B C D E Genescreatephenotype… Metabolism Teaches Us About Genes • Metabolic defects • studying metabolic diseases suggested that genes specified proteins • alkaptonuria (black urine from alkapton a.k.a. homogentisic acid ) • PKU (phenylketonuria) • each disease is caused by non-functional enzyme
1941 | 1958 Beadle & Tatum George Beadle Edward Tatum
1 Gene – 1 Enzyme Hypothesis • Beadle & Tatum • Compared mutants of bread mold, Neurospora fungus • created mutations by X-ray treatments • X-rays break DNA • inactivate a gene • wild type grows on “minimal” media • sugars + required precursor nutrient to synthesize essential amino acids • mutants require added amino acids • each type of mutant lacks a certain enzyme needed to produce a certain amino acid • non-functional enzyme = broken gene
Where does that leaveus?! So… What is a Gene? • One gene – one enzyme • all genes code for enzymes • but there are proteins that are not enzymes coded • One gene – one protein • a gene codes for a single protein • but many proteins are composed of several polypeptides chains each coded by a different gene • One gene – one polypeptide • but many genes code for only RNA • One gene – one product • but many genes can code for more than one product …
It’s hard to hunt for wabbits, if you don’t knowwhat a wabbitlooks like. polypeptide 1 polypeptide 2 polypeptide 3 Defining a Gene… “Defining a gene is problematic because… one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there are many other complications.” – Elizabeth Pennisi, Science 2003 gene RNA gene
For simplicity sake, let’s go back togenes that codefor proteins… The “Central Dogma” • How do we move information from DNA to proteins? transcription translation DNA RNA protein replication
From nucleus to cytoplasm… • Where are the genes? • genes are on chromosomes in nucleus • Where are proteins synthesized? • proteins made in cytoplasm by ribosomes • How does the information get from nucleus to cytoplasm? • messenger RNA
RNA • ribose sugar • N-bases • uracil instead of thymine • U : A • C : G • single stranded • mRNA, rRNA, tRNA, siRNA…. transcription DNA RNA
Types of RNA • mRNA – Messenger RNA Short single strand that carries a copy of the DNA code for one gene from the nucleus to the ribosome
Types of RNA • rRNA – Ribosomal RNA Combines with proteins to make the ribosome.
Types of RNA • tRNA – Transfer RNA Carries amino acids to the ribosome to build a protein chain.
Protein Synthesis Overview There are two steps to making proteins (protein synthesis): 1) Transcription (occurs in the nucleus) DNA RNA 2) Translation (occurs in the cytoplasm) RNA protein
Protein Synthesis Animations • From gene to protein animation • Protein Synthesis Overview Animation • Amoeba Sisters – protein synthesis • Teacher’s pet – protein synthesis
Transcription RNA
Transcription • Transcribed DNA strand = template strand • untranscribed DNA strand = coding strand • Synthesis of complementary RNA strand • transcription bubble • Enzyme that facilitates the building of RNA: • RNA polymerase
Transcription • Initiation • RNA polymerase binds to promoter sequence on DNA Role of promoter Sequence of base on DNA that are the signal to start reading = starting point 2. Strand being read = template strand
TATA box The promoter region of a gene is the transcription starting point Eukaryotic promoters commonly include a TATA nucleotide sequence The TATA box is ~ 25 nucleotides upstream from the transcription starting point
Transcription • Elongation • RNA polymerase unwinds DNA ~20 base pairs at a time • reads DNA 3’5’ • builds RNA 5’3’ (the enzyme governs the synthesis!) • No proofreading • 1 error/105 bases • many copies • short life
RNA Polymerase vs. DNA Polymerase Both can only assemble in the 5’ 3’ direction However, RNA polymerase can start a chain from scratch and do NOT require a primer to begin.
Transcription • Termination • RNA polymerase stops building mRNA at the termination sequence RNA GC hairpin turn
Prokaryote vs. Eukaryote Genetics • Differences between prokaryotes & eukaryotes • time & physical separation between processes • RNA processing
Transcription in Eukaryotes • only 1 prokaryotic enzyme • 3 eukaryotic RNA polymerase enzymes • RNA polymerase I and III • only transcribes rRNA genes • RNA polymerase II • transcribes genes into mRNA **each enzyme has a specific promoter sequence it recognizes
3' poly-A tail 3' A A A A A mRNA 5' cap P P P 5' G CH3 Eukaryotic Post-transcriptional Processing • Primary transcript • eukaryotic mRNA needs work after transcription • Protect mRNA • from RNA-ase enzymes in cytoplasm • add 5' G cap • add polyA tail • Edit out introns 50-250 A’s intron = noncoding (inbetween) sequence eukaryotic DNA exon = coding (expressed) sequence primary mRNA transcript pre-mRNA mature mRNA transcript spliced mRNA
Protecting RNA • 5’ methylated G cap added • G trinucleoside (G-P-P-P) • protects mRNA • from RNase (hydrolytic enzymes) • 3’ poly-A tail added • 50-250 A’s • helps export of RNA from nucleus • protects mRNA • from RNase (hydrolytic enzymes) UTR UTR
“AVERAGE” “gene” = 8000b pre-mRNA = 8000b mature mRNA = 1200b protein = 400aa lotsa“JUNK”! Dicing & Splicing mRNA • Pre-mRNA mRNA • edit out introns • intervening sequences • splice together exons • expressed sequences • In higher eukaryotes • 90% or more of gene can be intron • no one knows why…yet • there’s a Nobel prize waiting…
Splicing Enzymes • snRNPs • small nuclear RNA • RNA + proteins • Spliceosome • several snRNPs • recognize splice site sequence • cut & paste • RNA as a ribozyme • some mRNA can splice itself • RNA as enzyme
1982 | 1989 Ribozyme • RNA as enzyme Sidney Altman Thomas Cech Yale U of Colorado
Splicing Details • No room for mistakes! • editing & splicing must be exactly accurate • a single base added or lost throws off the reading frame AUGCGGCUAUGGGUCCGAUAAGGGCCAU AUGCGGUCCGAUAAGGGCCAU AUG|CGG|UCC|GAU|AAG|GGC|CAU Met|Arg|Ser|Asp|Lys|Gly|His AUGCGGCUAUGGGUCCGAUAAGGGCCAU AUGCGGGUCCGAUAAGGGCCAU AUG|CGG|GUC|CGA|UAA|GGG|CCA|U Met|Arg|Val|Arg|STOP
Hard to definea gene! Alternative Splicing • Alternative mRNAs produced from same gene • when is an intron not an intron… • different segments treated as exons
1977 | 1993 Discovery of Split Genes Richard Roberts Philip Sharp adenovirus NE BioLabs MIT common cold
Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y s s s s s s s s s s s s s s s s s s s s s s s s s s s s light chains s s s s s s s s antigen-binding site antigen-binding site heavy chains Structure of Antibodies Y antigen-binding site Y Y Y variable region Y Y Y Y Y light chain light chain heavy chains B cell membrane
How do vertebrates produce millions of antibody proteins, if they only have a few hundred genes coding for those proteins? antibody By DNA rearrangement & somatic mutation vertebrates can produce millions of B & T cells Translation of mRNA rearrangement of DNA mRNA V Transcription of gene D DNA of differentiated B cell J C C B cell chromosome of undifferentiated B cell
enhancer translation start translation stop exons 1000+b 20-30b RNA polymerase DNA UTR UTR introns transcription start transcription stop promoter pre-mRNA 5' 3' 5' 3' mature mRNA The Transcriptional Unit (gene?) transcriptional unit 3' 5' TAC ACT TATA DNA GTP AAAAAAAA
aa aa ribosome aa aa aa aa aa aa From Gene to Protein transcription translation DNA mRNA protein mRNA leaves nucleus through nuclear pores proteins synthesized by ribosomes using instructions on mRNA nucleus cytoplasm
Translation in Prokaryotes • Transcription & translation are simultaneous in bacteria • DNA is in cytoplasm • no mRNA editing needed
Prokaryotes DNA in cytoplasm circular chromosome naked DNA no introns Eukaryotes DNA in nucleus linear chromosomes DNA wound on histone proteins introns vs. exons Prokaryote vs. Eukaryote Genetics intron = noncoding (inbetween) sequence eukaryotic DNA exon = coding (expressed) sequence
TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA MetArgValAsnAlaCysAla protein ? How Does DNA Code for Proteins How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)?
Translation • Codons • blocks of 3 nucleotides decoded into the sequence of amino acids
ribosome TACGCACATTTACGTACGCGG DNA codon AUGCGUGUAAAUGCAUGCGCC mRNA AUGCGUGUAAAUGCAUGCGCC mRNA MetArgValAsnAlaCysAla protein ? mRNA Codes for Proteins in Triplets mRNA codes for proteins in triplets… CODONS!
The Genetic Code The genetic code is read 3 letters at a time. A codonconsists of three consecutive nucleotides that specify a single amino acid that is to be added to the polypeptide (protein). The four bases (letters) of mRNA (A, U, G, and C) are read three letters at a time (and translated) to determine the order in which amino acids are added to a protein.
The Codon Wheel • 64 different mRNA codons are possible in the genetic code. • But, there are only 20 different amino acids
More than one codon can code for the same amino acid • Example: GGG, GGU, GGA, GGC = Glycine • Some codons give instructions • Example: AUG = start • Example: UGA, UAA, UAG = Stop
Cracking the Secret Code • To decode a codon: • start at the middle of the circle and move outward. • Ex: CGA = Arginine • Ex: GAU = Aspartic Acid
The Code! • For ALL life! • strongest support for a common origin for all life • Code is redundant • several codons for each amino acid Why is this a good thing? • Start codon • AUG • methionine • Stop codons • UGA, UAA, UAG