ccarol
Uploaded by
61 SLIDES
646 VUES
610LIKES

From Gene to Protein: Understanding Genetics and Protein Synthesis

DESCRIPTION

Learn about the journey from genes to proteins using examples such as alkaptonuria and PKU. Explore the Central Dogma, transcription, translation, and the complexities of defining a gene. Discover how genetic information is processed in cells. Let’s study genetics and protein synthesis together!

1 / 61

Télécharger la présentation

From Gene to Protein: Understanding Genetics and Protein Synthesis

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. From Gene to Protein Chapter 17

  2. Bell Work AUG – UUA – CAU – AAC – AUA – AAU – CUG – GGG – UGA Get out the CH. 17 notes packet Can you transcribe the following DNA? TAC – AAT – GTA – TTG – TAT – TTA – GAC – CCC - ACT

  3. A B C D E Genescreatephenotype… Metabolism Teaches Us About Genes • Metabolic defects • studying metabolic diseases suggested that genes specified proteins • alkaptonuria (black urine from alkapton a.k.a. homogentisic acid ) • PKU (phenylketonuria) • each disease is caused by non-functional enzyme

  4. 1941 | 1958 Beadle & Tatum George Beadle Edward Tatum

  5. 1 Gene – 1 Enzyme Hypothesis • Beadle & Tatum • Compared mutants of bread mold, Neurospora fungus • created mutations by X-ray treatments • X-rays break DNA • inactivate a gene • wild type grows on “minimal” media • sugars + required precursor nutrient to synthesize essential amino acids • mutants require added amino acids • each type of mutant lacks a certain enzyme needed to produce a certain amino acid • non-functional enzyme = broken gene

  6. Where does that leaveus?! So… What is a Gene? • One gene – one enzyme • all genes code for enzymes • but there are proteins that are not enzymes coded • One gene – one protein • a gene codes for a single protein • but many proteins are composed of several polypeptides chains each coded by a different gene • One gene – one polypeptide • but many genes code for only RNA • One gene – one product • but many genes can code for more than one product …

  7. It’s hard to hunt for wabbits, if you don’t knowwhat a wabbitlooks like. polypeptide 1 polypeptide 2 polypeptide 3 Defining a Gene… “Defining a gene is problematic because… one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there are many other complications.” – Elizabeth Pennisi, Science 2003 gene RNA gene

  8. For simplicity sake, let’s go back togenes that codefor proteins… The “Central Dogma” • How do we move information from DNA to proteins? transcription translation DNA RNA protein replication

  9. DNA cannot leave the nucleus, so…

  10. From nucleus to cytoplasm… • Where are the genes? • genes are on chromosomes in nucleus • Where are proteins synthesized? • proteins made in cytoplasm by ribosomes • How does the information get from nucleus to cytoplasm? • messenger RNA

  11. RNA • ribose sugar • N-bases • uracil instead of thymine • U : A • C : G • single stranded • mRNA, rRNA, tRNA, siRNA…. transcription DNA RNA

  12. Types of RNA • mRNA – Messenger RNA Short single strand that carries a copy of the DNA code for one gene from the nucleus to the ribosome

  13. Types of RNA • rRNA – Ribosomal RNA Combines with proteins to make the ribosome.

  14. Types of RNA • tRNA – Transfer RNA Carries amino acids to the ribosome to build a protein chain.

  15. Protein Synthesis Overview There are two steps to making proteins (protein synthesis): 1) Transcription (occurs in the nucleus) DNA RNA 2) Translation (occurs in the cytoplasm) RNA  protein

  16. Protein Synthesis Animations • From gene to protein animation • Protein Synthesis Overview Animation • Amoeba Sisters – protein synthesis • Teacher’s pet – protein synthesis

  17. Transcription RNA

  18. Transcription • Transcribed DNA strand = template strand • untranscribed DNA strand = coding strand • Synthesis of complementary RNA strand • transcription bubble • Enzyme that facilitates the building of RNA: • RNA polymerase

  19. Transcription occurs in three main steps:

  20. Transcription • Initiation • RNA polymerase binds to promoter sequence on DNA Role of promoter Sequence of base on DNA that are the signal to start reading = starting point 2. Strand being read = template strand

  21. TATA box The promoter region of a gene is the transcription starting point Eukaryotic promoters commonly include a TATA nucleotide sequence The TATA box is ~ 25 nucleotides upstream from the transcription starting point

  22. TATA box

  23. Transcription • Elongation • RNA polymerase unwinds DNA ~20 base pairs at a time • reads DNA 3’5’ • builds RNA 5’3’ (the enzyme governs the synthesis!) • No proofreading • 1 error/105 bases • many copies • short life

  24. RNA Polymerase vs. DNA Polymerase Both can only assemble in the 5’  3’ direction However, RNA polymerase can start a chain from scratch and do NOT require a primer to begin.

  25. Transcription • Termination • RNA polymerase stops building mRNA at the termination sequence RNA GC hairpin turn

  26. Prokaryote vs. Eukaryote Genetics • Differences between prokaryotes & eukaryotes • time & physical separation between processes • RNA processing

  27. Transcription in Eukaryotes • only 1 prokaryotic enzyme • 3 eukaryotic RNA polymerase enzymes • RNA polymerase I and III • only transcribes rRNA genes • RNA polymerase II • transcribes genes into mRNA **each enzyme has a specific promoter sequence it recognizes

  28. 3' poly-A tail 3' A A A A A mRNA 5' cap P P P 5' G CH3 Eukaryotic Post-transcriptional Processing • Primary transcript • eukaryotic mRNA needs work after transcription • Protect mRNA • from RNA-ase enzymes in cytoplasm • add 5' G cap • add polyA tail • Edit out introns 50-250 A’s intron = noncoding (inbetween) sequence eukaryotic DNA exon = coding (expressed) sequence primary mRNA transcript pre-mRNA mature mRNA transcript spliced mRNA

  29. Protecting RNA • 5’ methylated G cap added • G trinucleoside (G-P-P-P) • protects mRNA • from RNase (hydrolytic enzymes) • 3’ poly-A tail added • 50-250 A’s • helps export of RNA from nucleus • protects mRNA • from RNase (hydrolytic enzymes) UTR UTR

  30. “AVERAGE” “gene” = 8000b pre-mRNA = 8000b mature mRNA = 1200b protein = 400aa lotsa“JUNK”! Dicing & Splicing mRNA • Pre-mRNA  mRNA • edit out introns • intervening sequences • splice together exons • expressed sequences • In higher eukaryotes • 90% or more of gene can be intron • no one knows why…yet • there’s a Nobel prize waiting…

  31. Splicing Enzymes • snRNPs • small nuclear RNA • RNA + proteins • Spliceosome • several snRNPs • recognize splice site sequence • cut & paste • RNA as a ribozyme • some mRNA can splice itself • RNA as enzyme

  32. 1982 | 1989 Ribozyme • RNA as enzyme Sidney Altman Thomas Cech Yale U of Colorado

  33. Splicing Details • No room for mistakes! • editing & splicing must be exactly accurate • a single base added or lost throws off the reading frame AUGCGGCUAUGGGUCCGAUAAGGGCCAU AUGCGGUCCGAUAAGGGCCAU AUG|CGG|UCC|GAU|AAG|GGC|CAU Met|Arg|Ser|Asp|Lys|Gly|His AUGCGGCUAUGGGUCCGAUAAGGGCCAU AUGCGGGUCCGAUAAGGGCCAU AUG|CGG|GUC|CGA|UAA|GGG|CCA|U Met|Arg|Val|Arg|STOP

  34. Hard to definea gene! Alternative Splicing • Alternative mRNAs produced from same gene • when is an intron not an intron… • different segments treated as exons

  35. 1977 | 1993 Discovery of Split Genes Richard Roberts Philip Sharp adenovirus NE BioLabs MIT common cold

  36. Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y s s s s s s s s s s s s s s s s s s s s s s s s s s s s light chains s s s s s s s s antigen-binding site antigen-binding site heavy chains Structure of Antibodies Y antigen-binding site Y Y Y variable region Y Y Y Y Y light chain light chain heavy chains B cell membrane

  37. How do vertebrates produce millions of antibody proteins, if they only have a few hundred genes coding for those proteins? antibody By DNA rearrangement & somatic mutation vertebrates can produce millions of B & T cells Translation of mRNA rearrangement of DNA mRNA V Transcription of gene D DNA of differentiated B cell J C C B cell chromosome of undifferentiated B cell

  38. enhancer translation start translation stop exons 1000+b 20-30b RNA polymerase DNA UTR UTR introns transcription start transcription stop promoter pre-mRNA 5' 3' 5' 3' mature mRNA The Transcriptional Unit (gene?) transcriptional unit 3' 5' TAC ACT TATA DNA GTP AAAAAAAA

  39. aa aa ribosome aa aa aa aa aa aa From Gene to Protein transcription translation DNA mRNA protein mRNA leaves nucleus through nuclear pores proteins synthesized by ribosomes using instructions on mRNA nucleus cytoplasm

  40. Translation in Prokaryotes • Transcription & translation are simultaneous in bacteria • DNA is in cytoplasm • no mRNA editing needed

  41. Prokaryotes DNA in cytoplasm circular chromosome naked DNA no introns Eukaryotes DNA in nucleus linear chromosomes DNA wound on histone proteins introns vs. exons Prokaryote vs. Eukaryote Genetics intron = noncoding (inbetween) sequence eukaryotic DNA exon = coding (expressed) sequence

  42. TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA MetArgValAsnAlaCysAla protein ? How Does DNA Code for Proteins How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)?

  43. Translation • Codons • blocks of 3 nucleotides decoded into the sequence of amino acids

  44. ribosome TACGCACATTTACGTACGCGG DNA codon AUGCGUGUAAAUGCAUGCGCC mRNA AUGCGUGUAAAUGCAUGCGCC mRNA MetArgValAsnAlaCysAla protein ? mRNA Codes for Proteins in Triplets mRNA codes for proteins in triplets… CODONS!

  45. The Genetic Code The genetic code is read 3 letters at a time. A codonconsists of three consecutive nucleotides that specify a single amino acid that is to be added to the polypeptide (protein). The four bases (letters) of mRNA (A, U, G, and C) are read three letters at a time (and translated) to determine the order in which amino acids are added to a protein.

  46. The Codon Wheel • 64 different mRNA codons are possible in the genetic code. • But, there are only 20 different amino acids

  47. More than one codon can code for the same amino acid • Example: GGG, GGU, GGA, GGC = Glycine • Some codons give instructions • Example: AUG = start • Example: UGA, UAA, UAG = Stop

  48. Cracking the Secret Code • To decode a codon: • start at the middle of the circle and move outward. • Ex: CGA = Arginine • Ex: GAU = Aspartic Acid

  49. The Code! • For ALL life! • strongest support for a common origin for all life • Code is redundant • several codons for each amino acid Why is this a good thing? • Start codon • AUG • methionine • Stop codons • UGA, UAA, UAG

More Related
SlideServe
Audio
Live Player
Audio Wave
Play slide audio to activate visualizer