1 / 25
Télécharger la présentation

DNA Tools & Techniques: Explore the World of Genetics

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Today • HK • MITOBIM, BLAST then MITOS • Direct sequencing: 16S and COIedit, assemble contigs (Codoncode), BLAST • *.ppt • Insert (plasmid) sequencing: edit, BLAST how to proceed.

  2. TOPICS.ppt 1 DNA discovery – Katerina Zlatkin 2 Restriction Enzymes – Nicole Caroll 3 Southern Blotting – Jonathan Locke 4 Cloning – Kimberly Wright 5 First sequencing methods/gene – Jessie Marlenee 6 BAC Libraries – Alan Buser 7 PCR – Katherine Graf 8 ESTs – John McCready 9 BLAST/GenBank – Zach Potts 10 microarrays – Vincent Cutillas 11 qPCR – Taylor Britton 12 Mitogenomics – Joe Medley 13 Genome sequencing – Ashlynn Bennett 14 forensics – Dante Trujillo 15 NGS – Pankoj Kumar Das 16 bioinformatics – Dillon Dugan 17 C-value paradox, nc RNA - 18 epigenetics – Madeline Jeshurin 19 RNAi – Rebeckah Ruiz 20 CRISPR – Matt Johnson 21 Phylogenetic genomics – Mariel Campbell 22 Archeological or commercial genomics -

  3. SNAILAND PARASITES BIOLOGY DNA “identity, possibilities” phylogenetics CTAB/DNAzol CTAB/DNAzol Illumina (full) genome sequencing gel electrophoresis nanodrop spec PCRrDNA/mito Qubit Fluorometry Covaris fragmentation Ampure (fragment collection) Kapa DNA library preparation kit Pippin size selection QC Bioanalyzer, Qubit, qPCR Illumina run TA cloning, B/W screening electrophoresis Qiagen plasmid extraction Restriction digests direct sequencing M13 sequencing Sequence ID (BLAST) editing Galaxy QC Data file (MT) genome assembly Mitos, manual annotation Gene annotation Primer design, walking Phylogenetics GenBank submission

  4. MITOBIM

  5. Illumina MITOBIM (BLAST) MITOS Logon to Galaxy, find your MITOBIM output. Copy the fasta file Generate a *.txt on desktop (Google to) MITOS and submit sequence for each of you. For protein coding sequences, indicate the correct genetic code. Inspect results next class.

  6. https://www.ncbi.nlm.nih.gov/Taxonomy/Utils/wprintgc.cgi

  7. https://www.ncbi.nlm.nih.gov/nuccore/KT008005.1 Echinostoma paraensei

  8. Pseudosuccinea columella mitochondrial COI gene for cytochrome oxidase subunit I, partial cds, isolate: Pc.2 Sequence ID: gi|972806524|LC015521.1Length: 667Number of Matches: 2 Related Information Range 1: 132 to 656GenBankGraphics Next Match Previous Match Alignment statistics for match #1 Score Expect Identities Gaps Strand 569 bits(630) 2e-158 432/525(82%) 0/525(0%) Plus/Plus Query 126 TTTTGTTATAAtttttttCATANTTATACCAATAATANTTGGAGGGTNNGGAAATTGAAT 185 |||||||||||||||||||||| |||||||||||||| ||||||||| ||||||||||| Sbjct 132 TTTTGTTATAATTTTTTTCATAGTTATACCAATAATAATTGGAGGGTTTGGAAATTGAAT 191 Query 186 AGTTCCNCTTCTCATTGGNGCTCCNNATATAANATTTCCTCGNATAAATAATATANNANN 245 |||||| ||||||||||| ||||| |||||| ||||||||| |||||||||||| | Sbjct 192 AGTTCCACTTCTCATTGGTGCTCCAGATATAAGATTTCCTCGTATAAATAATATAAGATT 251 Query 246 TTGATTACTACCACCTTCNNTTATTCTCTTACTTTGNTCTNGAATANNANAAGGTGGGGN 305 |||||||||||||||||| |||||||||||||||| ||| ||||| | ||||||||| Sbjct 252 TTGATTACTACCACCTTCGTTTATTCTCTTACTTTGCTCTAGAATAGTAGAAGGTGGGGT 311 Query 306 AGGNACTGGATGAACAGTTTACCCACCATTGANTGGACCTATTGCTCATGGNGGATCTTC 365 ||| |||||||||||||||||||||||||||| |||||||||||||||||| |||||||| Sbjct 312 AGGTACTGGATGAACAGTTTACCCACCATTGAGTGGACCTATTGCTCATGGTGGATCTTC 371 Query 366 TGNNGANNNNNCTATNNTNTCNNTNCNTNTANCCGGNTNATNNNNGATTTTAGGANNNNN 425 || || |||| | || | | | || |||| | || |||||||||| Sbjct 372 TGTTGATTTAGCTATTTTTTCTTTACATTTAGCCGGTTTATCCAGGATTTTAGGAGCAAT 431 Query 426 NNATTTTATTACTACnntttttAATATACNATCTCCNGGNATTACATTANANCNAANAAN 485 ||||||||||||| |||||||||||| |||||| || ||||||||| | | || || Sbjct 432 TAATTTTATTACTACAATTTTTAATATACGATCTCCAGGTATTACATTAGAACGAATAAG 491 Query 486 ATNATTTGTATGATCNGNATTAGTTACNGCTTNTNNNCTTCTTTTATCTNTNCNNNTACT 545 || |||||||||||| | ||||||||| |||| | |||||||||||| | | |||| Sbjct 492 ATTATTTGTATGATCTGTATTAGTTACAGCTTTTTTACTTCTTTTATCTTTACCAGTACT 551 Query 546 TGCAGGGGCAATTACNANGNTTTTNACANATCGAAATTTTNNTACNACTTNTTTTGATCC 605 ||||||||||||||| | | |||| ||| ||||||||||| ||| |||| ||||||||| Sbjct 552 TGCAGGGGCAATTACAATGCTTTTAACAGATCGAAATTTTAATACCACTTTTTTTGATCC 611 Query 606 TGCTGGAGGTGGNGATNNNATTTTATATCAACNTNNATTCTGATT 650 |||||||||||| ||| ||||||||||||| | ||||||||| Sbjct 612 TGCTGGAGGTGGTGATCCTATTTTATATCAACATTTATTCTGATT 656 Similar but not same Need to Redo some sequencing for quality Do phylogenetics for identification

  9. Direct sequencing Forward primer sequencing reaction sequencing generates + strand ATCG ggaa 5’ 3’ dye blobs Reverse primer sequencing reaction CCTT tagc 5’ generates - strand 3’ dye blobs

  10. Previous direct 16S and COI sequences: PE1: physid not definitive sequence missing/incomplete PE2: physid “” “” PE3: physid “” “” LE4: lymnaeid “” “” A2: ancylid “” “” more data

  11. A good PCR product • Correct size • ds DNA • (Primer 1) - amplified region – (primer 2) • Primers are artefacts, • Remove from experiemntal sequence

  12. *.ppt

  13. Sequence What is in the reaction?

  14. Add 2 ml of plasmid to the following BD sequencing reactions Group reaction F reaction R 1 1.4 3.2 2 2.4 4.1 3 3.2 5.1 4 4.1 5.4 5 5.1 7.1 6 5.4 8.2 7 7.1 10.1 8 8.2 10.2 9 10.1 1.4 10 10.4 2.4 1.4 EP1-18S 2.4 EP1-28S 3.2 EP1-18S 4.1 EP1-28S 5.1 EP1-18S 5.4 EP1-18S 7.1 EP3-18S 8.2 EP1-28S 10.1 EP3-28S 10.4 EP1-28S Start BD profile om thermal cycler: precipitate after

  15. asbennett@unm.edu abuser1@unm.edu ndcarroll@salud.unm.edu dchaveztrujillo@unm.edu ddugan@unm.edu kgraf07@unm.edu breanneh@unm.edu mjeshurin@unm.edu mjohnson8807@unm.edu jmccread@unm.edu medley@unm.edu becca3ruiz@unm.edu msmith235@unm.edu kzlatkin@unm.edu tbritton@unm.edu campmlc@unm.edu vcutillas@unm.edu dupkdas@gmail.com jonathanlocke@unm.edu jmarlenee@unm.edu zpotts@unm.edu ktwrig0412@unm.edu

More Related