Drosophila Genetic Laboratory

1. Drosophila Genetic Laboratory PI: 廖國楨/孫以瀚

2. Information a. Books Drosophila: A laboratory handbook The genome of Drosophilamelanogaster The development of Drosophilamelanogaster The embryonic development of Drosophilamelanogaster Drosophila: A practical approach Fly pushing b. The Flybase http://flybase.bio.indiana.edu mirror site http://flybase.nhri.org.tw The Basics of Fly Genetics:

3. Drosophila stocks 1. Wild-type stocks: Oregon-R and Canton-S 2. Mutant Stocks: Bloomington and Umea Stock Centers Fly Chromosomes Female X 2R 3R 4 2L 3L Male Y  Genetic map: e.g. 2-57 cM (centi-Morgan)  No recombination in males

4. ( ) () Type of Mutations • Point mutation • Inversion • Translocation • Compound chromosome • Duplication • Deficiency Polytenechromosome Physical mapping for chromosomal rearrangement, duplication and deficiency. X: 1-20 2L: 21-40 2R: 41-60 3L: 61-80 3R: 81-100 4: 101-104

5. Notum Fly Morphology Recognized Markers are the key to decipher genotypes. Mutations affecting body (color), eye (color and shape), wing (shape and vein) and bristle (shape and color)

6. Examples: Eye shape and color wild type Bar Sco Bristle

7. Sb and Hu Body color Bristle shape Wing shape wild type CyO

8. Nomenclature f; cnbw/CyO; TM3Sb1e1/ttkosn • Rules • order: X/Y; 2nd; 3rd; 4th chromosome • genotype: italicized • mutant names are abbreviated with three letters or fewer • TM stands for third multiple - a balancer chromosome • low case indicate recessive phenotype • uppercase in the first position indicate dominant phenotype • semi-colon separate genotype symbols • a genotype written on a single represent mutation on that chromosome is homozygous • anything that is not shown is presumed to be wild type; similarly, heterozygosity is only indicated by the mutant loci • allelic name is shown by superscript • eyDindicates that this particular allele is dominant. The gene symbols represent that original allele is recessive.

9. inhibit recombination function to trace chromosome and to maintain stock FM: first multiple SM: second multiple TM: third multiple Balancer Chromosomes Features: • Homozygous lethal except FM • Multiple inversion • At least one dominant marker Mating Scheme FM7a CyO nd nd multiple ; or X FM7a Sco Y virgin females FM7a CyO ; nd + Culture Condition 25 ℃and 60% humidity

10. Basic Fly Husbandry Working with Drosophila doesn’t require much technical skill. Care is essential. The power of fly genetics comes from the ability to perform cross in which each possible genotype in the progeny is recognized easily and unambiguously. Virgin females used in crosses are important factor. If flies are not healthy, it is important to recover enough of the progeny needed to continue the experiment. Rejuvenilization may be help. The healthiest way to keep fly stocks is at 25 ℃, 60% relative humidity. Temperature ranges from 29 ℃ to 18 ℃. True breeding stocks can be transferred w/o anesthetization. Method: Tap → off plug → new vial → tap flies to new vial → put plug back on. Usually, 10-15 females per vial are sufficient.

11. Coddling difficult strains: Use a fresh food vial garnished with fresh yeast paste (baker’s dried active yeast mixed to the consistency of peanut butter), keep the culture in ideal conditions (25 ℃, 60% RH), and say an occasional prayer. Foods: • Flour-treacle-agar • Yeast-glucose-agar • Instant potato medium • Casein-based defined medium • Yeast-cornmeal-molasses-agar • Apple juice medium Pests • Fungal control – Tegosept • Bacterial control – penicillin G (less problem) • Mite control -

12. For new stocks: • Keep all incoming stocks in quarantine • Make sure they are mite-free before put them into your fly room • The stocks quarantine for at least two generations • Good housekeeping will help to reduce happening of mite infection: • Autoclave all infected bottles and vials • Clean your bench, microscope and fly handle equipments regularly • Remove all old vials from fly room • Use cotton plug instead of foam plug • Use Tedion when mite infection becomes a serious problem Tedion (2,4,5,4’-tetrochloro-diphenyl sulfone) is dissolved in acetone at the final conc. 5000 ppm. Soak filter paper and leave them dry in the hood. Benzyl benzote can also be used in mite control. Make 50% solution in ethanol and soak filter paper. This chemical may kill some stocks.

13. Anaesthetizers: 1. Ether • Tip the flies to the bottom of vial or bottle. • Remove the plug and rapidly invert over the mouth of etherizer. • Replug the vial or bottle. • Wait until all flies have stopped moving. • Tip them on to the glass plate for examination. Two etherizers and one apparatus to prevent food from falling

14. 2. Carbon dioxide • Tip flies into the anaesthetizer. • Transfer to the porous ethylene film with CO2 the flowing through. Replace by a 16 G needle An apparatus using CO2 fir anaesthetizing flies Carbon dioxide has a number of advantages: • It is safer and more pleasant for the user • Flies are anaesthetized more quickly • They recover consciousness rapidly and will mate whereas ether delays mating 3. Triethylamine: usage is the same as ether. The anaesthetized effect is much longer than ether, but its toxicity is also higher.

15. Collecting Flies for Crosses ** All genetic crosses, females have to be virgin ** Virgins can be distinguished by their pale pigmentation, by their morphology, or by the presence of a dark spot in their abdomens . Alternatively, they can be collected on the basis of timing – female flies does not mate with the first 8 hour of emergence as adults. A more efficient method for maximizing the number of virgins present in the morning is to place the culture at 18 ℃ overnight, after your collection at the end of the day. Development is slowed down sufficiently at this temperature that there is roughly a 98% probability that newly emerged females will mate for 16 hours. Thus, your morning collections can be assumed to be virgins. Alternate 18 ℃ and 25 ℃. Although male:female is 1:1, female flies tend to emerge earlier. It is often convenient to store the flies you have collected and put 20 to 30 flies per vial. (Virgins should be used within 3 to 10 days). The best timing is to make crosses at Fri. The first progeny will emerge 10 days later, on Mon. During the storage period, it is also possible to ensure that you have actual virgin by seeing that no larvae appear.

16. The P-element transposon The P-element is much more commonly used in the fly community. • Tagging uncharacterized genes • Tagging a gene whose map position is well defined • Creating a new mutations with a P-element insertion • Creating deletions of a defined regions A 2907-bp DNA fragment poly A termination AUG ▲ ▲ Exon 0 Exon 1 Exon2 Exon 3 66 kD 31 bp repeat 31 bp repeat Transposase (87 kD from 2.7 kb mRNA)

17. pUC 3’ P 5’ P white BamHI HindIII 5XUASG  hsp70TATA  EcoRI BglII NotI XhoIKpnI XbaI SV40 polyA BamHI The P-element Mediated Germ-line Transformation 1. Preparation of DNA to be injected Two UASG vectors: Both vectors do not contain the start codon for translation in region between the transcription initiation and multiple cloning site. Therefore, the start codon has to be put in when you are making your P-element construct. Kozaksequence: AA/CA/CATGGC pUAST (Brand et al., 1993 development 118: 401)

18. pUASpD (derived from pUASp MOD 78:113) 5’ P pUC 3’ P white GAGA  7XUASG  XhoI  PTATA  KpnI NotI  BamHI BglII D-epitope  XbaI  K10 polyA  HindIII KpnI NotI GG TAC Ccg ccc ggg atc aga tcc GCG GCC GCa tag gcc act agt gga tct GGATCCAGATCTAGCCGTTCCGAGTCGAAGAGGAATCGCTTCTAG A BamHI BglII XbaI D-epitope Plasmid DNA to be injected has to be very clean. CsCl- double banded Column purified (endo-toxin free)- overload the column PEG8000 precipitated

19. To 50 mg plasmid DNA - measured by Spectrophotometer • add 5 mg of helper DNA • precipitate by ethanol twice - 0.3 M NaOAc • wash with 70% ethanol twice • resuspend in an injection buffer (100 ml) • (0.1 M KPO4 pH 6.8, 5 mM KCl) 2. Collection of embryos, dechorionation and the injection Set up a cage containing about 1000 flies Mesh w1118 ; 2-3 virgin females w1118 males or simply use w1118 For 2.5 liter 67.5 g agar 500 ml grape juice 75 g sugar 40 ml 10% Tegosept in ethanol Grape-juice plate with a glob of yeast paste at the center 9-cm petri dish

20. The first egg collection is discard because the first introduction of fresh medium stimulates females to lay eggs that have been held for a while. The second egg collection can be used to test the injection conditions, such as dryness of eggs and sharpness of needle. • There are three ways to remove chorion: • cutting egg shell using tungsten or sharp dissecting needle • gently rolling on double stick tape • soaking in bleach (50-100%) for 3-5 minutes After the chorion comes off, the anterior end can still be identified easily by the presence of tiny micropyle at that end. Dechorionated embryos are transferred onto a slide which has a very thin strip of double stick tape on it. Embryos can be picked up using a blunt dissecting needle or fine plastic fiber with a tiny glob of gum at the tip. (A gum solution, sticky dip, can be made by dissolving gum from double stick tape into heptane). The needle or fiber can be dipped into the dip to coat a small amount of gum on its tip. The embryos are orientated with their posterior ends protruding over the edge of the tape.

21. ~ 60 embryos Posterior ends of ebmryos Double stick tape How many embryos lined up for one injection depends on humidity of the room and personal skill. Embryos may need to be dessicated in order to make them to take up the injected DNA. The best condition in my lab is lining up ~60 embryos within 10 minutes and wait for 2 more minutes when humidity is at 75%. Harlocarbon oil, series 700, is then overlaid the embryos as thin as possible. They are ready to be injected. Injections are done with an inverted microscope and a micromanipulator. We have used an air-filled system, in which rubber tubing is hooked up a 50 cc plastic syringe attached to the needle holder in the micromanipulator. The injection needle is pulled from a 50 ml micropipet (Microcaps, Drummond; cat. # 1-000-5000). The pull condition depends on individual needle puller. The final diameter ranges from 2-6 mm. If the needle is too long, it would not be strong enough to insert embryos.

22. 1 X 3-5 w1118 per vial 2 X 2 w1118 If the needle is short, becoming wide too soon, the inserted part is too fat to keep cytoplasm from leakage after the needle is withdrawn. So, the final diameter, the sharpness of tip and the taper of the needle are all important factors. Embryo stages!!! After all embryos are injected, the slide is placed in a petri dish in which a piece of round Whatmann filter paper has been taped on the top and moistened with distilled water to keep the embryos in humid when they develop. The incubation temperature is 18 ℃. The survival larvae are transferred into vials containing the fly food. Usually, each vial should have at least 50 larvae, which prevents the food gone bad, but not more than 120. These larvae, kept at 25 ℃, would take 9 to 10 days to enclose. Adults are backcrossed to w1118.

23. Pole cells 3 2 4 5

24. 1 X 3-5 w1118 per vial 1 X 2 w1118 3. Screening of transformants and setting up lines Eye color of transformants ranges from pale yellow to red. This is a tendency that transformants with red eye color carry multiple insertions. If one vial gives more than four transformants, we just select four for the following procedures. Amplification is carried out by backcrossing to w1118. Progenies are used to set up two crosses: 1. Sibling cross for determining the insertion on X and setup a line 2. Cross with a double balancer, yw; CyO/Sp; TM6B/Dr for determining the insertion on 2nd and 3rd Both w+CyO and w+Hu progenies are crossed with w1118

25. The GAL4/UAS system was used to mis-express human genes in Drosophila Advantages: • avoid lethality • can be induced expression in various tissues with one single construct • various expression level  different degrees of severities Brand et al., 1993 development 118: 401

26. An example: a mammalian snk Overexpression of snk-GFPs in the eye imaginal disc Phase Three form of snks: KM: kinase dead wt: wild type TE: kinase consecutively active wt TE KM GFP

27. Ectopic snk expression results in rough eye Controls: OR & GMR-GAL4 OR GMR wt KM TE

28. GMR wt TE KM Ectopic snk expression results in loss of rhabdomeres The kinase activity is required

29. Isolate and identify modifers • Isolate mutants suppress or enhance the phenotype • Identify genes corresponding to the mutants • Characterize function of the genes wt eyg wt eyg