SlideServe
Télécharger Obtenir Pro
Menu
Accueil Pro
Préférences
ApparenceLight Aide et commentaires
© SlideServe · v2026

Genetic Architecture of Quantitative Traits: Lessons From Drosophila

melia avatar
melia
61 diapositives · 994 Views · Jul 22, 2014

Genetic Architecture of Quantitative Traits: Lessons From Drosophila. Trudy F. C. Mackay Department of Genetics & W. M. Keck Center for Behavioral Biology North Carolina State University Raleigh, NC 27695 USA. Evolutionary Quantitative Genetics.

#genetic architecture of quantitative traits: lessons from drosophila #genetic architecture of quantitative traits: lessons from drosophila ppt #powerpoint #presentation
Genetic Architecture of Quantitative Traits: Lessons From Drosophila - slide 1
01 / 61Genetic Architecture of Quantitative Traits: Lessons From Drosophila
1 / 17

Télécharger la présentation

Genetic Architecture of Quantitative Traits: Lessons From Drosophila
Une image / un lien ci-dessous est fourni (tel quel) pour télécharger la présentation

Politique de téléchargement : le contenu du site vous est fourni TEL QUEL pour votre information et votre usage personnel ; il ne peut être vendu, concédé sous licence ni partagé sur d’autres sites sans l’accord de son auteur.Le contenu vous est fourni TEL QUEL, pour votre information et votre usage personnel uniquement. Téléchargez la présentation en cliquant sur ce lien. Lors du téléchargement, si vous ne parvenez pas à télécharger une présentation, l’éditeur a peut-être supprimé le fichier de son serveur.Pendant le téléchargement, si vous ne parvenez pas à obtenir une présentation, le fichier a peut-être été supprimé par l’éditeur.

F I N

Plus de contenu associé

Transcription de la présentation

  1. Genetic Architecture of Quantitative Traits: Lessons From Drosophila Trudy F. C. Mackay Department of Genetics & W. M. Keck Center for Behavioral Biology North Carolina State University Raleigh, NC 27695 USA

  2. Evolutionary Quantitative Genetics • What maintains variation for quantitative traits within populations? • Do the same loci causing variation within populations also cause divergence between populations? Between species? • How predictable is evolution?

  3. Quantitative Traits Genetic Variation Environmental Variation Gene-Environment Interaction and Correlation

  4. AACTGGCCTCCTCCTCCTCCTATACGTTACCGG………………….CGATTCCAAAAACTGGCCTCCTCCTCCTCCTATACGTTACCGG………………….CGATTCCAAA AACTGGCCTCCT……………….ATACGTTACCGG………………….AAACCTTAGC AACTGGCCTCCT……………….ATACGTTACCGC………………….AAACCTTAGC AACTGGCCTCCT……………….ATACGTTACCGC……..3kb……..AAACCTTAGC

  5. Genetic Resources Genetic Manipulation Model Organism

  6. Properties of Mutations Affecting Quantitative Traits 1 2 3

  7. Properties of Mutations Affecting Quantitative Traits Large Mutational Target Size 23.3% 6.2% 21.9% • Many Loci • Novel, unexpected loci • Candidate genes? 32.7% 34.7% Norga et al. 2003, Curr. Biol. 13: 1388-1397 Harbison et al. 2004, Genetics 166: 1807-1823 Sambandan et al. 2006, Genetics 174: 1349-1363 Yamamoto et al. 2008, PNAS105: 12393-12398 Edwards et al. 2009, BMC Biology 7: 29. Magwireet al. 2010, PLoS Genetics 6: e1001037 Morozova, Anholt and Mackay, submitted 41.1% 24.8% 37.1%

  8. Properties of Mutations Affecting Quantitative Traits Sex-Specific, -Biased and -Antagonistic Effects are Common • 5-33% increase • Most sex-specific • rFM = -0.3* Magwire et al. 2010, PLoS Genetics 6: e1001037

  9. Properties of Mutations Affecting Quantitative Traits Variable Mutational Effects per Locus Magwire et al. 2010, PLoS Genetics 6: e1001037

  10. × Properties of Mutations Affecting Quantitative Traits EpistasisRevealed by Diallel Cross Analysis Federowiczet al. 1998, Genetics 148: 1885-1891

  11. Properties of Mutations Affecting Quantitative Traits Epistasisis Common…. Sambandanet al. 2006, Genetics 174: 1349-1363 Yamamoto et al. 2008, PNAS105: 12393-12398

  12. CG10990 crol BG00817 BG00004 BG00297 mub CG9238 pyd esg CG31531 Properties of Mutations Affecting Quantitative Traits ….and Can be Sex-Specific CG10990 crol BG00817 Males Females BG00004 BG00297 mub CG9238 pyd esg CG31531 Magwire et al. 2010, PLoS Genetics 6: e1001037

  13. Properties of Mutations Affecting Quantitative Traits Pervasive Pleiotropy Variable pleiotropiceffects Single mutations have pleiotropic effects on hundreds of gene expression traits Morozovaet al. 2011, Genetics 187:1193-1205

  14. Properties of Mutations Affecting Quantitative Traits Different Epistatic Networks for Pleiotropic Traits neur neur neur Nmdar1 Nmdar1 Nmdar1 LanA LanA LanA Gp150 Gp150 Gp150 Btk29A Btk29A Btk29A sgl sgl sgl Zwarts, Callaerts, Anholt and Mackay, unpublished

  15. Linkage Mapping of Quantitative Trait Loci (QTLs) • Unbiased • Numbers of markers not too large • Drosophila: Complementation tests to deficiencies and mutations to identify position candidate genes • BUT • Need large sample sizes to localize QTLs to genes using only linkage mapping • Limited genetic diversity

  16. Properties of Segregating Variation Affecting Quantitative Traits Many Loci, Novel Loci Dilda & Mackay 2002, Genetics 162: 1655.

  17. Properties of Segregating Variation Affecting Quantitative Traits Sex-biased, -Specific and -Antagonistic Effects are Common Leips& Mackay 2000, Genetics 155: 1773-1788

  18. Properties of Segregating Variation Affecting Quantitative Traits Environment-Specific Effects (GEIs) are Common Leips& Mackay 2000, Genetics 155: 1773-1788

  19. Properties of Segregating Variation Affecting Quantitative Traits Evidence for Non-Additive Effects From h2 and H2 Response to selection from outbred population: h2 Mean Aggression Score Variation among inbred lines: H2 Generation

  20. Properties of Segregating Variation Affecting Quantitative Traits Evidence for Non-Additive Effects From h2 and H2 Mackay et al. 2005, PNAS 102: 6622-6629; Edwards et al. 2006, PLoS Genetics 2: 3154; Jordan et al. 2007, Genome Biol. 8: R172; Morozova et al. 2009, Genetics 83: 733-745; Ayroles et al. 2009, Nat. Genet. 41: 299-307; Edwards et al. 2009, Genome Biol. 10: R76; Morozova et al. 2009, Genetics 83: 733-745

  21. Properties of Segregating Variation Affecting Quantitative Traits Evidence for Epistasis From QTL Mapping RIL  Oregon RIL  2b • Sex- and cross-specific epistasis • Interactions not always between QTLs with main effects Mackay et al. 2006, Handbook of the Biology of Aging, 6th Edition

  22. Properties of Segregating Variation Affecting Quantitative Traits Association Mapping of QTLs • Greater power to localize QTLs than linkage mapping • Large sample of genetic diversity • Can map to gene level and below if linkage disequilibrium declines rapidly with physical distance (Drosophila) • BUT • Can be biased • Need all molecular polymorphisms (deep sequencing)

  23. Fly GWAS: Drosophila Genetic Reference Panel (DGRP) 192 • Living library of genetic variation • Community resource for association mapping complex traits • Multiple complex organismal phenotypes, intermediate molecular phenotypes, multiple environments • Illumina sequences > 12x, 168 lines to date • Genotypes called using JGIL (Eric Stone)

  24. Genetic Variation for Complex Traits in DGRP Lines Starvation Resistance Chill Coma Recovery Ethanol Sensitivity Life Span Locomotion Mating Behavior Sleep Aggression Fitness

  25. And Also…. Olfactory behavior (adult and larvae) Locomotor behavior in response to drugs Phototaxis Geotaxis Learning and memory Foraging behavior Circadian rhythm Sperm precedence Cuticular hydrocarbons Oxidative stress resistance Immune response Metabolic traits Development time Body size Wing morphology Pigmentation Etc….. Whole genome transcript abundance Ecologically relevant environments

  26. SNPs in DGRP Lines >4 Million SNPs in 168 lines Even more indels, CNVs, TEs DGRP Consortium, unpublished

  27. Allele Frequency Spectrum and Population Structure Count Minor Allele Frequency 0 0.1 0.2 0.3 0.4 0.5 DGRP Consortium, unpublished

  28. Rapid Local Decay of LD DGRP Consortium, unpublished

  29. GWAS for Startle Response Most significant SNPs are low frequency Standardized effects not small Many significant SNPs (FDR < 0.1) Many sex-specific effects Local LD 72 genes DGRP Consortium, unpublished

  30. Relationship Between Effect Size and MAF

  31. GWAS for Startle Response 141.7% total VG M: Mutant Q: in QTL R: Rapidly evolving BE: Increased brain expression MS: Missense DGRP Consortium, unpublished

  32. Genotype-Phenotype Prediction 7 SNPs r2 = 0.513 r = 0.716

  33. P-element mutations Natural variants • P screen not comprehensive • MAF of natural variants 1-5% (low power) • Large mutational target size • Many loci affect natural variation

  34. Systems Genetics: Biology of Quantitative Traits Revealed Through Transcriptome Mackay et al.2009, Nat Rev Genet. 10:565

  35. Genetic Variation In Gene Expression in DGRP Lines Number H2 = VL/(VL + VE) H2 = VL/(VL + VE) Number expressed transcripts: 14,480 Number genetically variable (Y = Sex+ Line + Sex×Line + ε): 10,096 Ayroleset al. Nat Genet. (2009) 41:299.

  36. Genetically Correlated Transcripts Transcript B Transcript B Transcript B Transcript A Transcript A Transcript A

  37. Genetically Correlated Transcripts Transcript C Transcript B Transcript Abundance Transcript A Transcript D Genotype / Line B A C D

  38. Genetically Correlated Transcripts Stone & Ayroles PLoS Genet. (2009) 5:e1000479.

  39. Modules of Genetically Correlated Transcripts In DGRP Lines 1500 1000 Count 500 0.3 0.5 0.1 0.4 0.6 0.2 Mean |r| Ayroles et al. Nat Genet. (2009) 41:299.

  40. Meaningful Modules 7 18 Module 7 Male Biased Module 18 Female Biased Ayroles et al. Nat Genet. (2009) 41:299.

  41. Quantitative Trait Transcripts attacin-c saliva CG14959 CG1146 Ayroles et al. Nat Genet. (2009) 41:299.

  42. DrosophilaSystems Genetics: Quantitative Trait Transcripts 355 414 691 1228 133 231 275 874 295 Ayroleset al. Nat Genet. (2009) 41:299; Harbisonet al. Nat Genet. (2009) 41:371; Edwards et al. Genome Biol. (2009) 10:R76.

  43. Drosophila Systems Genetics: Correlated Transcript Modules Associated With Phenotypes Day Sleep Night Sleep 1.0 0.0 -1.0 Life Span Starvation Resistance Chill Coma Recovery Locomotion Fitness Mating Behavior Ayroleset al. Nat Genet. (2009) 41:299; Harbisonet al. Nat Genet. (2009) 41:371

  44. Drosophila Systems Genetics: Correlated Transcript Modules Associated With Phenotypes Transcriptional network associated with aggressive behavior Edwards et al. Genome Biol. (2009) 10:R76.

  45. Reality Check: Mutations in QTTs Affect Gene Expression Focal Gene Genetically Correlated Genes Morozova et al. 2009. Genetics 183: 733-745

  46. Expression Quantitative Trait Loci (eQTLs) C B A D C B A D