chin
Uploaded by
17 SLIDES
359 VUES
170LIKES

Class 5: RNA Structure Prediction

DESCRIPTION

Class 5: RNA Structure Prediction. RNA types. Messenger RNA (mRNA) Encodes protein sequences Transfer RNA (tRNA) Adaptor between mRNA molecules and amino-acids (protein building blocks) Ribosomal RNA (rRNA) Part of the ribosome, a machine for translating mRNA to proteins

1 / 17

Télécharger la présentation

Class 5: RNA Structure Prediction

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Class 5:RNA Structure Prediction .

  2. RNA types • Messenger RNA (mRNA) • Encodes protein sequences • Transfer RNA (tRNA) • Adaptor between mRNA molecules and amino-acids (protein building blocks) • Ribosomal RNA (rRNA) • Part of the ribosome, a machine for translating mRNA to proteins • mi-RNA (micro-) • Sn-RNA (small nuclear) • RNA-I (interfering) • Srp-RNA (Signal Recognition Particle)

  3. Functions of RNAs Information Transfer: mRNA Codon -> Amino Acid adapter: tRNA Other base pairing functions: ??? Enzymatic Reactions: Structural: Metabolic: ??? Regulatory: RNAi

  4. RNA World Hypothesis • Before the “invention” of DNA and protein, early organisms relied on RNA for both genetic and enzymatic processes • DNA was a selective advantage because it greatly enhanced the fidelity of genetic replication • Proteins were a selective advantage because they make much more efficient enzymes • Remnants of the RNA world remain today in catalytic RNAs in ribosomes, polymereases and slicing molecules

  5. Why is RNA structure important? • Messenger RNA is a linear, unstructured sequence, encoding an amino-acid sequence • Most non-coding RNA’s adopt 3D structures and catalyse bio-chemical reactions. • Predicting structure of a new RNA => information about its function

  6. Terminology of RNA structure • RNA: a polymer of four different nucleotide subunits: • adenine (A) , cytosine (C), guanine (G)and uracil (U) • Unlike DNA, RNA is a single stranded molecule folding intra-molecularly to form secondary structures. • RNA secondary structure = set of base pairings in the three dimensional structure of the molecule • G-C has 3 hydrogen bonds • A-U has 2 hydrogen bonds • Base pairs are almost always stacked onto other pairs, creating stems.

  7. Base Pairing in RNA guanine cytosine adenine uracil

  8. Non-canonical pairs and pseudoknots • In addition to A-U and G-C pairs, non-canonical pairs also occur. Most common one is G-U pair. • G-U is thermodynamically favourable as Watson-Crick pairs (A-U, G-C) . • Base pairs almost always occur in nested fashion. Exception: pseudoknots.

  9. Elements of RNA secondary structure

  10. RNA Secondary Structure(more…)

  11. AGCTACGGAGCGATCTCCGAGCTTTCGAGAAAGCCTCTATTAGC

  12. RNA Tertiary Structure • Do not obey “parantheses rule”

  13. tRNA structure

  14. Structure vs Sequence • Homologous RNA’s that have common secondary structure without sharing significant sequence similarity are important. • It is advantageous to search conserved secondary structure in addition to conserved sequence in databases.

  15. Two Problems • RNA secondary structure for a single sequence. The dynamic programming algorithms – Nussinov and Zuker, SCFG algorithms. • Analysis of multiple alignments of families of RNA’s. Covariance Models – used for both multiple alignment and database searches.

  16. Problem I: Structure Prediction • Input:An RNA sequence X • Output: Most likely secondary structure of X • Algorithms: Nussinov, CYK, MFOLD, …

  17. Problem II: RNA family modeling • Input:A family for RNA sequence X1, …, XN sharing a common secondary structure • Aligned / Not aligned • Output: A probabilistic generative model representing the RNA family • Model: Covariance model

More Related