1 / 7

His pull-down assay for Orf6 in Mycobacterium sp. strain JC1 -> Yeast two hybrid

His pull-down assay for Orf6 in Mycobacterium sp. strain JC1 -> Yeast two hybrid Study for rv3676 -homolog in Mycobacterium sp. strain JC1 1. Primer extension 2. Mutagenesis CO oxidizer Pseudonocaridia was deposit in KCCM Pandoraea 16s rDNA sequencing Tsukamurella

chung
Télécharger la présentation

His pull-down assay for Orf6 in Mycobacterium sp. strain JC1 -> Yeast two hybrid

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. His pull-down assay for Orf6 in Mycobacterium sp. strain JC1 -> Yeast two hybrid Study for rv3676-homolog in Mycobacterium sp. strain JC1 1. Primer extension 2. Mutagenesis CO oxidizer Pseudonocaridia was deposit in KCCM Pandoraea 16s rDNA sequencing Tsukamurella CO-DH expression in M. tuberculosis ? Northern blot or Western blot Confirmation of transcription level in Mycobacterium sp. strain JC1 (under SNP) cutBCA, orf1-6… Confirmation of transcription level in Mycobacterium smegmatis (under SNP) CO-DH expression in Mycobacterium smegmatis

  2. CutR expression pMal C2X vector 이용 -> sequencing 의뢰 Searching the anti-tuberculosis drug from natural compound 흰쌀, 지골피, 측백잎, 황경피나무껍질, 마늘, 고삼, 백급, 대추, 의이인 분자설계연구소 200 개의 compound test. test 완료. XDH inhibitor Allopurinol, oxypurinol, BOF 4272, FYX, Y-700, TEI-6720 CO-DH purification from Mycobacterium smegmatis Mutagenesis for das gene Searching the single crossover mutant candidates CO-DH expression in Mycobacterium sp. strain JC1 mod mutant

  3. Paper work • Mycobacterium sp. strain JC1 CO-DH cloning Cosmid library Primer extension 2. Mycobacterium sp. strain JC1 RubisCO cloning Library screening method… Mycobacterium smegmatis mc2-155 No cbbLS gene in database has key enzymes for reverse TCA cycle PCR product for cbbLS gene in Mycobacterium smegmatis mc2-155 wild type, orf2- mutant, and orf4- mutant. Southern blot for cbbL gene

  4. Confirm : #41, 49, 57 61, 70, 77, 81, 84, 92, 94, 97, 112, 114, 119, 150 ,151, 152, 161, 169, 174, 176

  5. A B 1 2 3 1 2 3 SMB-CO 507 5.0 427 SMB-MeOH 7.0 8.5 15.6 27.4 5.0 0.8 SMB-glucose 105.6 91.2 34.6 0.29 0.27 0.25 A : CBB staining B : CO-DH activity staining Lane 1 : Mycobacterium sp. strain JC1 wild type Lane 2 : Mycobacterium sp. strain JC1 copy I CO-DH deletion mutant Lane 2 : Mycobacterium sp. strain JC1 copy II CO-DH deletion mutant

  6. IR1 CACGCGCTGAACGTACCCGAGGGCCAGTTAAGCGATTCCTTAAGGGGGGTGTTGAGAGCTCGCTTCGACTGCGTCTACCG GTGCGCGACTTGCATGGGCTCCCGGTCAATTCGCTAAGGAATTCCCCCCACAACTCTCGAGCGAAGCTGACGCAGATGGC TCGCAGACCGCGGTGTCGATCGCGGCTGAGATCATCGCGTGCCAGTGGGGTGGTGGCGGGCGTCCGCTGGCCCAGCTCGG AGCGTCTGGCGCCACAGCTAGCGCCGACTCTAGTAGCGCACGGTCACCCCACCACCGCCCGCAGGCGACCGGGTCGAGCC TGGCCGCATCCATCACGAGTGGGGGTCTGACGTGGGCAAACGCGGCTCCGATTACGGATCAGACCCCGAGTTAAGTGATT ACCGGCGTAGGTAGTGCTCACCCCCAGACTGCACCCGTTTGCGCCGAGGCTAATGCCTAGTCTGGGGCTCAATTCACTAA CCTTAACTCGCTATTGACGCCATCGCGGCGGCAACGGAAACTAGCCACTTCAGCCACGACGTTGTGAGGATGATCACATG GGAATTGAGCGATAACTGCGGTAGCGCCGCCGTTGCCTTTGATCGGTGAAGTCGGTGCTGCAACACTCCTACTAGTGTAC -35 (cutR) -10 (cutR) cutR +1 (cutR) +1 (cutB1) -35 (cutB1) -10 (cutB1) cutB1 CBS IR2 +1 (cutB1) -35 (cutB1) -10 (cutB1)

  7. 3’ G G G G G A A T T C C T T A G 5’ 1 2 T A C G cutB primer extension cutR primer extension 3’ G T T T G C G C C G A 5’ T C G A glucose CO 3’ G G T G A A G T C G 5’

More Related