1 / 28

Sequences and their Properties

Sequences and their Properties. Nucleotides. DNA A, T, G, C RNA A, U, G, C. Annealing. Nucleic acids can base pair with their reverse complement sequence. Two opposing forces affect annealing Hydrogen bonds favours annealing Phosphate groups favours denaturation.

colette-myers
Télécharger la présentation

Sequences and their Properties

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Sequences and their Properties

  2. Nucleotides • DNA • A, T, G, C • RNA • A, U, G, C

  3. Annealing • Nucleic acids can base pair with their reverse complement sequence • Two opposing forces affect annealing • Hydrogen bonds favours annealing • Phosphate groups favours denaturation

  4. Annealing-Melting Point (Tm) • The Tm is the temperature at which 50% of the nucleic acid molecules are in a single stranded state (or double stranded) • The Tm is a function of: • Percentage G:C • Ionic composition of the environment • The percentage of complementarity • Estimate of Tm • =2(#A:T) + 4(#G:C)

  5. (38%) G+C (52%) 0 50 100 (58%) (66%) 70 80 90 100 Tm Vs percentage G:C % Double stranded Temperature (C)

  6. (0.1M NaCl) (0.2M NaCl) (0.5M NaCl) 70 80 90 100 Tm Vs Conc. of Positive Ions 0 50 100 % Double stranded Temperature (C)

  7. (25%) (50%) (100%) 70 80 90 100 Tm Vs percentage of Complementarity 0 50 100 % Double stranded Temperature (C)

  8. Stringency • Percentage of complementarity required to allow the formation of stable duplexes • The Tm influences the stringency conditions required to allow annealing • A high stringency requires a high level of complementarity • GATCCGGTTATTA vs GATCCGGTTATTA CTAGGCCAATAATCTTGGACGATAAT

  9. Parametersthat Influence Stringency •  [salt] = High stringency •  Temperature = High stringency • [salt] = ? •  Temperature = ?

  10. Wash 4. Hybridization with Free Probe

  11. Detection: Autoradiography

  12. Complete; ideal; 100% complementarity Partial continuous; acceptable 100% complementarity Partial discontinuous; more difficut Partial complementarity Properties of the Probe • Complementarity • Complete or partial?

  13. Hybridization Stringency

  14. The Probe • Labelled DNA or RNA molecule • Single stranded • Strand specific(sensespecific) • Double stranded • Strand non-specific(sensenon specific)

  15. X ray film S S S S ENZ ENZ ENZ ENZ Ab-Dig conjugated Y Y Y Y Probe+ Dig D D D D D D D D Target Membrane Digoxygenin Labelled Probe • Indiret detection Peroxidase

  16. Hybridization Signals • Hybridization • Specific • Non specific • Background • Binding of probe to membrane • Binding of Ab to membrane

  17. Decoding the Genetic Information • Information encoded in nucleotidesequencesiscontained in discreteunits • The genes • The information contained in the genesistranscribed to generate the RNAs and thendecoded (translated) to generate the proteins

  18. Protein Coding Sequences • ProteincontainingsequencescontainORFs • Start – ATG • Stop – TAG, TGA, TAA

  19. Transcription - Translation Transcription: RNA pol Translation: Ribosomes NH3-M-T-R-S-W-G-L-I-S-I-COOH

  20. ORFs • All double strandedsequencesnecessarily have 6 reading frames GCCGATTAGAGA> TGCCGATTAGAG> ATGCCGATTAGA> • 5’-ATGGCGATTAGAGACAGCCATTAA-3’ • 3’-TACTGCTAATCTCTGTCGGTAATT-5’ <CTGTCGGTAATT <TCTGTCGGTAAT <CTCTGTCGGTAA • How many ORFs does this sequence have?

  21. Homologues • Gene sequencesthatpossess a commonancestor • Homologues share a highlevel of identity • Identity • Percentage of bases or aminoacidsthat are the samebetweendifferentsequences

  22. Nucleotide Homologues • DNA sequenceswithgreater 70% identity • Ex. A homologue of the humanhemoglobingeneisfound in soya G.G.T.G.A.G.G.G.T.A.T.C.A.T.C.C.C.A.T.C.T.G G.G.T.C.A.G.G.A.T.A.T.G.A.T.T.C.C.A.T.C.A.C * * * * * * * * * * * * * * * * 77% identity

  23. Protein homologues • Proteinsequenceswithgreaterthan 25% identity • Ex. A protein homologue of the humanhemoglobinisfound in soya G A R G G W L G.G.T.G.A.G.G.G.C.A.T.C.A.T.C.C.C.A.T.C.T G.G.T.C.A.G.G.A.C.A.T.G.A.T.T.C.C.A.T.C.A G T P M I W E Percentageidentity: 28%

  24. Homologues • Orthologues : • Homologues found in differentorganismswhich have a commonancestor • Duplication followed by speciation • Paralogues : • Homologues foundwithin the samespecies • Duplication prior to speciation

  25. Mutations

  26. Point Mutations • Missense - Neutral Synonymous/Silent : • Base change that does NOT change the amino acid coded • Ex. AGG → CGG both Arg • Missense - Non-Synonymous - Conserved: • Base change results in a different but similar amino acid • Same charge and shape • Ex. AAA → AGA Lys to Arg both basic amino acids

  27. Point Mutations • Missense - Non-Synonymous-Semi conserved: • Base change resulting in a different but similar amino acid • Same shape but different charge • Ex. CGC → CUC Arg (Polar) to Leu (Non-polar) • Missense - Non-Synonymous - Non conserved • Base change resulting in totally different amino acids • Different shape different charge

  28. Point Mutations • Nonsense point mutation: • Base change resulting in the creation of a premature stop codon within the ORF • Causes premature translation termination • Truncated protein • Indel – Insertion or deletion of a single base within the ORF • Changes reading frame • Changes protein sequence • May cause premature termination

More Related