1 / 25

Introduction of Genetics

Introduction of Genetics. Review Genetic blue-print: DNA Mitosis When Mitosis Goes Wrong. How do cells know what to do?. Each cell has a set of genetic codes that store all the information needed to keep the cell active and happy

csilla
Télécharger la présentation

Introduction of Genetics

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Introduction of Genetics Review Genetic blue-print: DNA Mitosis When Mitosis Goes Wrong

  2. How do cells know what to do? • Each cell has a set of genetic codes that store all the information • needed to keep the cell active and happy • These genetic codes are called Deoxyribonucleic Acid (DNA) • DNA has different names depending on its structure at that time Chromatin: (coiled thread of DNA) has a spaghetti-like structure Chromosome: (super-condensed chromatin) has an X-structure DNA strands: (least-condensed form) has a double helix

  3. Double-stranded DNA helix • DNA structure model was proposed by Watson and Crick •  which looks like a spiral stair case (Double-stranded DNA Helix) • This means: there are two (2) DNA strands that are chemically • connected to keep them together and twisted. These • chemical connections form bonds, much like the rungs • of your ladder at home. • DNA is made up of 4 different nucleotides. • i) Adenine • ii) Thymine • iii) Cytosine • iv) Guanine

  4. Double-stranded DNA helix • DNA pairing is very unique: C -pair with- G A –pair with-T • DNA strands twist into a helix structure after proper nucleotide pairing

  5. Let’s figure out how pairing works! • Here is one of the DNA strand, can you find out what would be the • nucleotide sequence for the second DNA strand? GGGTACTTAAACCGTATTACAAGT

  6. Gene • DNA strand can be very long but • not everything on it is important • or codes information. • If you think a DNA strand as a story, • then all of the interesting sentences • that are found in the story would be • equivalent to that of genes. • Genes are small parts of a DNA strand • that store valuable information. • More simply: •  genes code genetic information

  7. Genetic Determination Each cell has two (2) copiesof the genetic information  1 from mom  1 from dad 46 chromosomes Each individual organism has a slightly different set of genes, this refers to as the individual’s genotype. The genotype of an individual influences the outcome of the visible features of the organism, which refers to as the individual’s phenotype 4 chromosomes 16 chromosomes

  8. Review of Cell Division & Basic Genetic Principles

  9. 1) For single-celled organisms to reproduce.2) For multicellular organisms to grow and repair.3) For the replacement of damaged cells. What is the Purpose of Cell Duplication?

  10. How does cell divide? … Mitosis • Mitosis is the term that is used to describe the process in which cells • make a lot of copies of itself. • Mitosis has 2 parts: • i) cell cycle (copying DNA) • ii) cytokinesis (cell division step)

  11. Cell cycle check-points • Most of the time, the cell is in Interphase • G1 (GAP-1): cell growth & preparation for copying DNA • S (Synthesis): process of copying DNA • G2 (GAP-2): cell growth & preparation • for mitosis • M (mitosis): cell multiplication • division of nucleus • Cell cycle repeats; • sometimes it rests (Go) • At those checkpoints, if something • is not normal, the cell will undergo • programmed cell death (apoptosis)

  12. Some Important Terminology • Cells ‘normal’ chromosome number is known as the diploid number and is represented as 2N. • Diploid because all chromosomes belong to a set or pair. • Human diploid number is 46 23 pairs of chromosomes. • Cells can be 4N (tetraploid) just prior to mitosis. • Cells can also be 1N or haploid in the case of sperm or egg (meiosis).

  13. Mitosis Cell cycle:copying DNA i)Interphase ii) Prophase iii) Metaphase iv) Anaphase v) Telophase Cytokinesis: cell division IPlay Me ATune …

  14. Interphase:“Getting Ready for Mitosis” Because DNA must be split evenly between the two cells it initially replicates and condenses (coils up into tight bundles) into a chromosome - two sister chromatids separated by a centromere. Chromosome centromere sister chromatids

  15. Chromosomes • During interphase are long thin strands known as chromatin • Upon replication, two strands of chromatin are joined at centromere • During prophase when they are visible, individual strands of chromosomes are called chromatids chromosome Centromere chromatid

  16. Mitosis Stage 1:Prophase • Nuclear membrane disappears • chromatin fibres become short, thick and visible • centrioles move to opposite poles of cell creating spindle fibersand astral rays • NOTE – no centrioles in plant cells

  17. Mitosis Stage 2:Metaphase • Chromatid fibres line up along the equatorial plate of cell. • Spindle fibres attach at the kinetochore, which is located at the centromere of each chromosome.

  18. Mitosis Stage 3:Anaphase • Chromatid fibres are drawn towards the ends of the cell • centromeres replicate • Chromatids appear to follow the path made by the spindle fibres

  19. Mitosis Stage 4:Telophase • Two new cells begin to form as cytoplasm pinches off at cleavage furrow • nuclear membrane forms around two new nuclei • spindle fibres, astral rays disappear • Cytokinesis = splitting of two daughter cells

  20. Mitosis Video http://www.youtube.com/watch?v=VlN7K1-9QB0

  21. Mitosis in Plant Cells Similar to animal cell division, except: • nocentrioles • during telophase when two daughter cells form, cells are divided by cell plate

  22. What if Mitosis goes wrong? • Scenario 1: Mitosis stops prematurely • you will not grow properly (eg. partial organs) • you will not be able to heal when injured • Thalidomide Agent orange

  23. What if Mitosis goes wrong? • Scenario 2: Mitosis keeps going non-stop • you will get a tumour which may become cancerous Breast cancer Lip cancer (from smoking)

  24. Important Terminology • Sex Chromosome = a chromosome that determines the sex (male or female) of an organism. • Autosome = a chromosome that is not involved in determining the gender of an organism. • Chromatid = half of a chromosome • Sister Chromatid = one of the two duplicated chromosomes • Homologous Chromosomes = pairs of chromosomes carrying different forms of the same gene (e.g. one homologous pair encodes for blue eyes, the other homologous pair encodes for brown eyes, but they both encode for eye colour). • Allele = a different form of the same gene (e.g. one allele encodes for black hair vs. another allele that encodes for blonde hair).

  25. Textbook Reading • Unit 2- Chapter 4-Genetic Processes • Read page 160-165 • Answer Q’s 1-6 on page 164- Learning Check • Draw and take notes on the events which occur in each of the phases of Meiosis- page 170-171 • Start working on your Genetic Concept Map

More Related