dberger
Uploaded by
33 SLIDES
352 VUES
330LIKES

Today

DESCRIPTION

Improve the identity of snails through plasmid sequencing and direct sequence editing, and analyze data quality using BLAST. Initiate precipitation and extension products for Illumina sequencing.

1 / 33

Télécharger la présentation

Today

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

Playing audio...

  1. Today • HK • Plasmid sequencing, precipitate • *.ppt • Direct sequence editing and BLAST data quality, improve, identity of snails • 15.00h initiate precipitation extension products • Illumina sequencing • Assembly : MITOS OK

  2. SNAILAND PARASITES BIOLOGY DNA “identity, possibilities” phylogenetics CTAB/DNAzol CTAB/DNAzol Illumina (full) genome sequencing gel electrophoresis nanodrop spec PCRrDNA/mito Qubit Fluorometry Covaris fragmentation Ampure (fragment collection) Kapa DNA library preparation kit Pippin size selection QC Bioanalyzer, Qubit, qPCR Illumina run TA cloning, B/W screening electrophoresis Qiagen plasmid extraction Restriction digests direct sequencing M13 sequencing Sequence ID (BLAST) editing Galaxy QC Data file (MT) genome assembly Mitos, manual annotation Gene annotation Primer design, walking Phylogenetics GenBank submission

  3. Sequence What is in the reaction?

  4. Add 2 ml of plasmid to the following BD sequencing reactions Group reaction F reaction R 1 1.4 3.2 2 2.4 4.1 3 3.2 5.1 4 4.1 5.4 5 5.1 7.1 6 5.4 8.2 7 7.1 10.1 8 8.2 10.2 9 10.1 1.4 10 10.4 2.4 Start BD profile om thermal cycler: precipitate after

  5. *.ppt

  6. SNAIL IDENTITIES?

  7. DNA SANGER SEQUENCING “*.ABI” Sequence analysis?

  8. Forward primer sequencing reaction sequencing generates + strand ATCG ggaa 5’ 3’ dye blobs Reverse primer sequencing reaction CCTT tagc 5’ generates - strand 3’ dye blobs

  9. Possible outcomes NNNNN NNNNNNNNNNNNNNNNNNNNNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGNNGNNNNNNNNNNNNNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNNNNNNGGGGGGGNGNGGNNNGGNNNNNNNNNNNNNNNNNA Failed reactions: due to Dead chemistry (BigDye, primers) Contaminants (inhibitors) Salt/Organics Too much/little template (wedge) Loss of extension products (precipitation, running)

  10. http://www.nucleics.com/DNA_sequencing_support/DNA-sequencing-failed-reaction.htmlhttp://www.nucleics.com/DNA_sequencing_support/DNA-sequencing-failed-reaction.html ALSO see: http://seqcore.brcf.med.umich.edu/doc/dnaseq/trouble/badseq.html

  11. NNNNNNNNNNNNNNNNNNNNNNNNNNNGNTNNNGNAAGTNNNNNNNNNNNNNGGTACNANNNNNNNNNNNNNNNNNTNTTNTCCNNANGGTAATTTANNNNNNNNNNNNCNNCNNATANNNNNCATAAAATTTTTTTAATAAAATTAGAAAAGTTTCTTTTAAGTTTTTGNNNNNNNGNNNNNCCAACAAAAAATTAGGATGTAATCTATTTTTTCTATTTAAAAAAATGTTATACACTTTTCTTTAAAAATTCTAAGGGTCTTCTCGTCTTTTTTCTAAATTACTGGTATTTTCACCAGATAAACAAATTAAAAAAACACTAATTATTATAGCTACTATTCATTACTTCTTTCATTCCAGACTACAATTAATAGCCAATTGATTATGCTACCTTAGCACAGTCAAGGTACTGCGGCCGTTAATAAAGTTACACCGGGCAGAAGATATCAATAATCTTTTAAAAAATTTTCTACTGACTATGTTTNNNNNAAACAGGCGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNTNNNGNAAGTNNNNNNNNNNNNNGGTACNANNNNNNNNNNNNNNNNNTNTTNTCCNNANGGTAATTTANNNNNNNNNNNNCNNCNNATANNNNNCATAAAATTTTTTTAATAAAATTAGAAAAGTTTCTTTTAAGTTTTTGNNNNNNNGNNNNNCCAACAAAAAATTAGGATGTAATCTATTTTTTCTATTTAAAAAAATGTTATACACTTTTCTTTAAAAATTCTAAGGGTCTTCTCGTCTTTTTTCTAAATTACTGGTATTTTCACCAGATAAACAAATTAAAAAAACACTAATTATTATAGCTACTATTCATTACTTCTTTCATTCCAGACTACAATTAATAGCCAATTGATTATGCTACCTTAGCACAGTCAAGGTACTGCGGCCGTTAATAAAGTTACACCGGGCAGAAGATATCAATAATCTTTTAAAAAATTTTCTACTGACTATGTTTNNNNNAAACAGGCGANNN END?? ALSO see: http://seqcore.brcf.med.umich.edu/doc/dnaseq/interpret.html

  12. So full length? Abrupt end Primer? Same for other sequencing reaction

  13. ? LCO1490: 5'-GGT CAA CAA ATC ATA AAG ATA TTG G -3’ HC02198: 5'-TAA ACT TCA GGG TGA CCA AAA AAT CA-3’ Primer is reverse complement at end of sequence run

  14. Sequence reverse complemented LCO1490: 5'-GGT CAA CAA ATC ATA AAG ATA TTG G -3’ HC02198: 5'-TAA ACT TCA GGG TGA CCA AAA AAT CA-3’ Primer is reverse complement at end of seqeunce run

  15. Sequence reverse complemented LCO1490: 5'-GGT CAA CAA ATC ATA AAG ATA TTG G -3’ HC02198: 5'-TAA ACT TCA GGG TGA CCA AAA AAT CA-3’ Primer is reverse complement at end of sequence run

  16. Fix “N” calls: what are these? Stay at regular spacing distance

  17. Fix “N” calls: what are these? Stay at regular spacing distance

  18. Dye Blobs? Edit under the blob

  19. A G C G T N A A NNNN Dye Blobs? Edit under the blob

  20. A G C G T N A A NNNN T T G A C G A G C A T T T T T A Dye Blobs? Edit under the blob

  21. BLAST

  22. BLAST

  23. Pseudosuccinea columella mitochondrial COI gene for cytochrome oxidase subunit I, partial cds, isolate: Pc.2 Sequence ID: gi|972806524|LC015521.1Length: 667Number of Matches: 2 Related Information Range 1: 132 to 656GenBankGraphics Next Match Previous Match Alignment statistics for match #1 Score Expect Identities Gaps Strand 569 bits(630) 2e-158 432/525(82%) 0/525(0%) Plus/Plus Query 126 TTTTGTTATAAtttttttCATANTTATACCAATAATANTTGGAGGGTNNGGAAATTGAAT 185 |||||||||||||||||||||| |||||||||||||| ||||||||| ||||||||||| Sbjct 132 TTTTGTTATAATTTTTTTCATAGTTATACCAATAATAATTGGAGGGTTTGGAAATTGAAT 191 Query 186 AGTTCCNCTTCTCATTGGNGCTCCNNATATAANATTTCCTCGNATAAATAATATANNANN 245 |||||| ||||||||||| ||||| |||||| ||||||||| |||||||||||| | Sbjct 192 AGTTCCACTTCTCATTGGTGCTCCAGATATAAGATTTCCTCGTATAAATAATATAAGATT 251 Query 246 TTGATTACTACCACCTTCNNTTATTCTCTTACTTTGNTCTNGAATANNANAAGGTGGGGN 305 |||||||||||||||||| |||||||||||||||| ||| ||||| | ||||||||| Sbjct 252 TTGATTACTACCACCTTCGTTTATTCTCTTACTTTGCTCTAGAATAGTAGAAGGTGGGGT 311 Query 306 AGGNACTGGATGAACAGTTTACCCACCATTGANTGGACCTATTGCTCATGGNGGATCTTC 365 ||| |||||||||||||||||||||||||||| |||||||||||||||||| |||||||| Sbjct 312 AGGTACTGGATGAACAGTTTACCCACCATTGAGTGGACCTATTGCTCATGGTGGATCTTC 371 Query 366 TGNNGANNNNNCTATNNTNTCNNTNCNTNTANCCGGNTNATNNNNGATTTTAGGANNNNN 425 || || |||| | || | | | || |||| | || |||||||||| Sbjct 372 TGTTGATTTAGCTATTTTTTCTTTACATTTAGCCGGTTTATCCAGGATTTTAGGAGCAAT 431 Query 426 NNATTTTATTACTACnntttttAATATACNATCTCCNGGNATTACATTANANCNAANAAN 485 ||||||||||||| |||||||||||| |||||| || ||||||||| | | || || Sbjct 432 TAATTTTATTACTACAATTTTTAATATACGATCTCCAGGTATTACATTAGAACGAATAAG 491 Query 486 ATNATTTGTATGATCNGNATTAGTTACNGCTTNTNNNCTTCTTTTATCTNTNCNNNTACT 545 || |||||||||||| | ||||||||| |||| | |||||||||||| | | |||| Sbjct 492 ATTATTTGTATGATCTGTATTAGTTACAGCTTTTTTACTTCTTTTATCTTTACCAGTACT 551 Query 546 TGCAGGGGCAATTACNANGNTTTTNACANATCGAAATTTTNNTACNACTTNTTTTGATCC 605 ||||||||||||||| | | |||| ||| ||||||||||| ||| |||| ||||||||| Sbjct 552 TGCAGGGGCAATTACAATGCTTTTAACAGATCGAAATTTTAATACCACTTTTTTTGATCC 611 Query 606 TGCTGGAGGTGGNGATNNNATTTTATATCAACNTNNATTCTGATT 650 |||||||||||| ||| ||||||||||||| | ||||||||| Sbjct 612 TGCTGGAGGTGGTGATCCTATTTTATATCAACATTTATTCTGATT 656 Similar but not same Need to Redo some sequencing for quality Do phylogenetics for identification

  24. Chromatograms • IN CHROMAS • EDIT: look to see whether you can do better than the computer algorithm. • Evaluate the peak pattern to Insert, delete, reassign residues • Retrieve sequence from chromatograms • BLAST F and R sequences toward identification of species of origin • COMPLETE TABLE ON BOARD

  25. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3711436/pdf/gkt371.pdfhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC3711436/pdf/gkt371.pdf

  26. MITOBIM

  27. MITOBIM How to check the output from MITOBIM: Log into Galaxy, Look at MITOBIM output, SELECT ALL And BLASTN against GENBANK https://blast.ncbi.nlm.nih.gov/Blast.cgi

  28. CLEAN-UP sequencing reactions. DO NOT DISTURB THE PELLET! These are your sequencing products. 1). Set up two 1.7ml eppendorf tubes, labeled group number, target and F or R and add 100 μl 100% EtOH and 4 μl 3M NaAc. Spin sequencing reactions, then transfer whole volume from the PCR tubes to the correctly labeled tubes. Invert and spin 10’ max RPM at room temperature. 2). Discard supernate, rinse pellet with 400 μl 75% EtOH, spin 5’ max RPM at room temperature. 3). Discard supernate, take out last few drops, dry to air, give to instructor for reading of extension products.

More Related