350 likes | 533 Vues
DNA Structure and Protein Synthesis (also known as Gene Expression). Protein Synthesis. The process of making proteins… Boring stuff? Nope This is how the information in your genes is used to build… you!. DNA. Deoxyribonucleic Acid (DNA) is found in what part of the cell?
E N D
DNA Structure and Protein Synthesis (also known as Gene Expression)
Protein Synthesis • The process of making proteins… • Boring stuff? • Nope • This is how the information in your genes is used to build… you!
DNA • Deoxyribonucleic Acid (DNA) is found in what part of the cell? • How is the DNA organized? Chromosomes! Nucleus
Each strand of DNA is a POLYMER!! • Individual nucleotides are the monomers! • Monomers (nucleotides) are linked to form a long polymer of single-stranded DNA • In our cells, 2 DNA polymers are bonded together to form a LONG double-stranded polymer
The Parts of a Nucleotide • SUGAR – deoxyribose • Phosphate group (PO4) • Nitrogen-containing base
What are the 4 BASES? ADENINE THYMINE CYTOSINE GUANINE
A DNA POLYMER!! • Strong bonds hold the nucleotides together to form a ‘backbone’. • They occur between the sugar of one nucleotide and the phosphate of the next nucleotide.
MORE ABOUT THE BASES… • Adenine always bonds to thymine • Cytosinealways bonds toguanine
Adenine –Thymine (A-T) • Cytosine-Guanine (C-G)
How does DNA Replicate? • DNA replication is making a COPY of ALL the genetic information (ALL the bases of DNA). • This has to happen BEFORE cell division (either Mitosis or Meiosis) can occur. • WHY does it have to happen?
The role of DNA • The material that genes are made of… • Gene - segment of DNA that carries the information necessary to build a protein. • Information is encoded in the sequence (order) of the four DNA bases (ATGC). • A gene is a sequence of thousands of these bases that codes for a protein!
The DNA in a single human cell = 3,000,000,000 bases (3 Billion!) • However, scientists were surprised that there are only about 30,000 genes!!
DNA is Double Stranded Molecule • The four bases that make up the genetic code (ATGC) form complimentary pairs. • A pairs with T… G pairs with C. • If one strand is ACGCAATTGCATT • The other is TGCGTTAACGTAA • This makes it possible for DNA copy it’s self…
Make a complementary strand! • TTCCGATCGGCGTATCTGAGCGATCAG…. AAGGCTAGCCGCATAGACTCGCTAGTC
What is a gene? • A Segment of DNA that contains the information that codes for a protein!!!
How do genes result in proteins? • The DNA is in the NUCLEUS of the cell. • Proteins are made on the ribosomes- where? • In the cytoplasm! • So, the information needs to leave the nucleus….. • Can the DNA can leave the nucleus?
NO, it cannot! • The information for the gene needs to be copied in a way that the information CAN leave the nucleus! • This process is the 1st step in Protein Synthesis- TRANSCRIPTION
Transcription: • The information in the DNA is copied into a molecule of RNA (Ribonucleic acid). • DNA can’t leave the nucleus so …a messenger (copy) is sent. • mRNA is the messenger.
How is RNA different from DNA? • Monomer is a nucleotide with Ribose sugar, nitrogen base, and phosphate group • In RNA, nitrogen bases are: Adenine, Guanine, Cytosine, and URACIL • Complementary base pairs are C-G; A-U)
RNA is Single Stranded; DNA is double stranded • DNA: ATGCGTTAC • mRNA: UACGCAAUG
http://www.dnalc.org/resources/3d/03-mechanism-of-replication-basic.htmlhttp://www.dnalc.org/resources/3d/03-mechanism-of-replication-basic.html
Transcribe this DNA sequence! • DNA: GCCTTAAGACATTGTATGCCTAGCTAG • Complementary mRNA: CGGAAUUCUGUAACAUACGGAUCGAUC
What are differences between mRNA & DNA • Location? • Nucleotides? • Double stranded? Single Stranded? • How much genetic information is contained?
TRANSLATION • What do you do when you go from one language to another? You TRANSLATE! • mRNA carries the instructions for building the protein • It takes place on the ribosomes (cellular machine that makes the protein by joining amino acids)
Translation • The Sequence (order) of bases in the DNA/RNA determines the order of amino acids in the protein! • The information is translatedfrom the language of DNA/RNA (nucleic acids) to the language of proteins (amino acids).
What does the cell need to translate a mRNA? • mRNA- information for making the protein • tRNA- type of RNA that actually translates the information from nucleic acid (RNA) to amino acid (protein) • Ribosome- the “machine” where translation takes place; binds the mRNA, tRNA, and joins the corresponding amino acids (the monomers of proteins!)
How is the mRNA translated to make a protein? • Correct tRNA with an amino acid attached “reads” 3 nucleotides (a codon) in the mRNA and puts the correct amino acid in the growing polypeptide (unfolded protein!). • This happens in the ribosome!!
Summary of transcription and translation Transcription – A copy of the information in DNA for a gene is encoded into RNA (takes place in nucleus). Translation – The RNA (messenger) serves as the plan for building a protein using tRNA as the translator and the ribosome as the “machine” (takes place in cytoplasm)
http://www.lew-port.com/10712041113402793/lib/10712041113402793/Animations/Protein%20Synthesis%20%20long.swfhttp://www.lew-port.com/10712041113402793/lib/10712041113402793/Animations/Protein%20Synthesis%20%20long.swf